Home Latest Articles
Latest Articles
  • Xingxing Zhang, Feiyu Yang, Tianbing Ren, Yingxin Zheng, Xiao-Bing Zhang, Lin Yuan
    Chinese Chemical Letters. 2023, 34(5): 107835-.

    Two-photon imaging has attracted increasing attention owing to its deep tissue imaging capabilities. Therefore, many fluorophores have been developed to satisfy its requirements. However, long-wavelength emission fluorophores with an optically tunable group are rarely developed. In this study, two long-wavelength emission fluorophores with an optically tunable amino group were successfully developed by introducing strong electron acceptor and large conjugated group to the TPQL dye. TPCO2 displayed a bright red emission (λem = 638 nm, Φ = 0.15) together with high two-photon action cross section and good water solubility, which enabled higher signal-to-background ratios and deep tissue imaging. The proof-of-concept probe (TPCONO2) was successfully applied to the high signal-to-background ratio imaging of nitroreductase in liver fibrosis, further realizing diagnosis of the degree of hypoxia during liver fibrosis.

  • Mei-Chen Liu, Hui-Jun Chen, Gang Wu, Xiu-Li Wang, Yu-Zhong Wang
    Chinese Chemical Letters. 2023, 34(5): 107546-.

    Separators is indispensable for the normal operation of lithium-ion batteries (LIBs). However, the widely used commercial polyolefin separators have some inherent deficiencies such as poor thermotolerance, high inflammability and inferior electrolyte wettability, which restrict their further applications of the advanced and safe batteries. Herein, we design a novel thermotolerant (a shrinkage percentage of 0% at 300 ℃) and flame retarded aerogel separator consisting of aramid nanofibers (ANFs). Because of its high porosity (86.5% ± 6.1%) and excellent electrolyte uptake (695%), the ANFs aerogel separator has an ionic conductivity of 1.04 mS/cm and a high lithium-ion transference number (0.67), which can endow LIBs with outstanding rate performance and superior cycling performance. Specifically, the ANFs aerogel separator-based batteries possess a discharge specific capacity of 102 mAh/g with a capacity retention of 90.7% and a Coulombic efficiency of 99.3% after 600 cycles at 5 C. In addition, under an operated temperature of 90 ℃, the battery with ANFs aerogel separator can still conduct the very steady charge-discharge, presenting a capacity retention of 90.1% and a Coulombic efficiency of 99.6% after 200 cycles at 3 C. Accordingly, the separator can probably serve as a potential candidate for application to advanced and safe LIBs.

  • Jie Feng, Lei Zhao, Wenda Zhang, Cheng Li, Congling Yin, Xiaojun Kuang
    Chinese Chemical Letters. 2023, 34(5): 107551-.

    The discovery of new perovskite compounds under high pressure mainly focuses on the ABO3 compositions and the compositions highly deviated from ABO3 are less explored. Here we demonstrate that the La6Sr3Si6O24 silicate composition can be stabilized as a hexagonal perovskite-related structure with isolated tetrahedra anions under high pressure of 6 GPa. The compound adopts 9-layer shifted hexagonal perovskite-like structure with both B-cation and oxygen deficiencies and contains pseudo-cubic (c′) (La/Sr)O2 layers and hexagonal (h) (La/Sr)O3 layers stacked according to (chh)3 sequence. This structure features both B-cation vacancy ordering between the two consecutive hexagonal layers and oxygen vacancy ordering in c′-(La/Sr)O2 layers, resulting in isolated tetrahedral SiO4 anions and ionic conduction behavior. This work demonstrates the practicability of accessing new perovskite-related functional materials from the compositions highly deviated from ABO3 under high pressure.

  • Qiangying Zhang, Xin Tan, Tao Yu
    Chinese Chemical Letters. 2023, 34(5): 107748-.

    High residual concentration of arsenic and fluoride is a tricky problem to be solved in the process of reinjection after geothermal water utilization. We develop a method to simultaneously remove As(Ⅴ) and F from geothermal water using magnetic Fe3O4@MgO adsorbent, fabricated via a one-step method. The effects of pH, contact time, adsorbent dose and temperature on the removal efficiency were investigated systematically. The results show that the Fe3O4@MgO composite has a wide range of pH (2–11), ultrafast removal dynamics (As(Ⅴ): 2 min; F: 30 min), and high removal efficiency (As(Ⅴ): 99.9%; F: 96.6%). The adsorption kinetics follows the pseudo-second-order kinetics model, and the adsorption isotherm model fits Freundlich. The adsorption capacity of As(Ⅴ) and F can reach 123 and 98.4 mg/g, respectively. The exchange of As(Ⅴ) and F with Mg-hydroxyl groups hydrolysis by MgO was determined the adsorption mechanism. The Fe3O4@MgO adsorbent was capable of achieving the adsorption efficiency as high as 99.9% for As(Ⅴ) and 97.3% for F in real geothermal water, respectively. Hence, the proposed Fe3O4@MgO composite exhibited as an excellent adsorbent for the remediation of As- and F-contaminated geothermal water.

  • Ye Yang, Mingchan Liang, Rui Wang, Chunmao He
    Chinese Chemical Letters. 2023, 34(5): 107806-.

    Tyrosine sulfation is an important post-translational modification that enhances the inhibitory activity of hirudin. Herein, we developed a facile synthetic strategy to afford the sulfated hirudins with up to three modifications and in multi-milligram scales, after a single HPLC purification step. Through these synthetic proteins, a novel type of modulation mechanism exhibited by tyrosine sulfation was proposed, which would help to delineate the structure–function relationships in other sulfated proteins and more importantly, to serve as a basis for the development of related antithrombotic agents.

  • Jiawei Ji, Li Han, Wang Song, Jingfang Sun, Weixin Zou, Changjin Tang, Lin Dong
    Chinese Chemical Letters. 2023, 34(5): 107769-.

    Understanding the influence of sulfates over catalysts for selective catalytic reduction of NO with NH3 (NH3-SCR) is crucial due to the universal presence of SO2 in exhaust gas. Depending on the degree of sulfation, there mainly exist surface and bulk sulfates and NH3-SCR activity is generally considered to suffer more from bulk sulfates. Herein, the unique function of bulk sulfates over CeO2 in promoting high-temperature SCR reaction is revealed. Notably, compared with CeO2 dominated with surface sulfates (S-CeO2–4h) and commercial V2O5-WO3/TiO2, CeO2 with bulk sulfates (S-CeO2–72h) exhibits admirable NO conversion at the temperature range of 400–550 ℃. Bulk sulfates provide more Brønsted acid sites with stronger strength for NH3 adsorption. Moreover, the oxidation ability of CeO2 is significantly inhibited due to electron-withdrawing effect from bulk sulfates, which alleviates NH3 oxidation at high temperatures. More NH3 adsorption with high stability and limited NH3 oxidation capacity ensure the excellent catalytic performance for S-CeO2–72h in high-temperature denitration. This work provides new insight of bulk sulfates in promoting SCR activity and open a new avenue to design deNOx catalysts employed at high temperatures.

  • Shaolie Zheng, Wei Huang, Nan Li, Yuan Shen, Xiaoyu Wang, Tianfeng Chen
    Chinese Chemical Letters. 2023, 34(5): 107764-.

    Comprehensive surgical staging or optimal tumor cytoreductive surgery of malignant ovarian cancer directly affects disease prognosis. Therefore, a fluorescent selenium nanoparticle (Se@RGD/S2.2) decorated with cancer-targeting Arg-Gly-Asp (RGD) peptides and GCAGTTGATCCTTTGGATACCCTGG aptamer (S2.2) was developed for use as a diagnostic agent to achieve rapid, noninvasive diagnosis and visualization of microinvasive lesions during surgery for malignant ovarian cancer.

  • Qiwen Wang, Wenwen Bu, Zonghang Li, Yu Qi, Xiaohong Wang
    Chinese Chemical Letters. 2023, 34(5): 107548-.

    Novel polyoxometalate (POM) Pickering interfacial catalyst (PIC) was fabricated through loading (NH4)5H6PMo4V8O40 (PMo4V8) on both alkyl and alkyl-amino groups functionalized silica nanoparticles. PMo4V8/SiO2(C8/C8NH2 with molar ratio as 1:1) PIC system provided a new catalytic model for aerobic conversion of 5-hydroxymethylfurfural (5-HMF), as well as its recovery and product separation in H2O/methyl isobutyl ketone (MIBK) biphase reaction. Balancing the ratio of PMo4V8, C8 and C8NH2 gave rise to variety in hydrophilicity and hydrophobicity for PMo4V8/SiO2(C8/C8NH2), which enhanced the transformation of 5-HMF to 2, 5-diformylfuran (DFF) in H2O/MIBK with 73.7% yield at 81.8% conversion than in H2O or MIBK single phase.

  • Qian-Cheng Luo, Ning Ge, Yuan-Qi Zhai, Tengbo Wang, Lin Sun, Qi Sun, Fanni Li, Zhendong Fu, Yan-Zhen Zheng
    Chinese Chemical Letters. 2023, 34(5): 107547-.

    Two erbium(Ⅲ) complexes [ErCl(OArAd)3][Na(THF)6] (1) and Er(OArAd)3 (2) are successfully prepared by using one variety of "hard" base ligand with large steric hindrance. The coordination geometry around the Er(Ⅲ) site changes from distorted tetrahedral to flat trigonal pyramid geometry in different solvent environment due to the removal of the coordinated chloride. Such an alternation significantly enhances the single-molecule magnet (SMM) behavior and makes the field-induced effective energy barrier (Ueff) arrive at 43(1) cm−1 for the latter. Together with theoretical calculations, this study shows that strong equatorial ligand field and high local symmetry are critical to suppress the quantum tunneling of the magnetization (QTM) and achieve high-performance erbium(Ⅲ) based SMMs.

  • Xiaobing Chen, Huan Yang, Xu Song, Hong Liang, Yu Wei, Jiao Lu, Matthias Barz, Rongrong Jin, Yu Nie
    Chinese Chemical Letters. 2023, 34(5): 107753-.

    The integrated lipopeptide (RVA)/gene complexes are fabricated with bi-directional regulation on tumor cells and micro-environment. After self-assembling and target coating modification, the poly(γ-glutamic acid) (γ-PGA)/RVA nano-vectors can sequentially respond to pH & redox stimuli, and guarantee efficient therapeutic gene delivery and control release of all-trans retinoic acid. The design provides a facile but promising strategy to treat refractory cancers.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498