Latest ArticlesTwo-photon imaging has attracted increasing attention owing to its deep tissue imaging capabilities. Therefore, many fluorophores have been developed to satisfy its requirements. However, long-wavelength emission fluorophores with an optically tunable group are rarely developed. In this study, two long-wavelength emission fluorophores with an optically tunable amino group were successfully developed by introducing strong electron acceptor and large conjugated group to the TPQL dye. TPCO2 displayed a bright red emission (λem = 638 nm, Φ = 0.15) together with high two-photon action cross section and good water solubility, which enabled higher signal-to-background ratios and deep tissue imaging. The proof-of-concept probe (TPCONO2) was successfully applied to the high signal-to-background ratio imaging of nitroreductase in liver fibrosis, further realizing diagnosis of the degree of hypoxia during liver fibrosis.
Separators is indispensable for the normal operation of lithium-ion batteries (LIBs). However, the widely used commercial polyolefin separators have some inherent deficiencies such as poor thermotolerance, high inflammability and inferior electrolyte wettability, which restrict their further applications of the advanced and safe batteries. Herein, we design a novel thermotolerant (a shrinkage percentage of 0% at 300 ℃) and flame retarded aerogel separator consisting of aramid nanofibers (ANFs). Because of its high porosity (86.5% ± 6.1%) and excellent electrolyte uptake (695%), the ANFs aerogel separator has an ionic conductivity of 1.04 mS/cm and a high lithium-ion transference number (0.67), which can endow LIBs with outstanding rate performance and superior cycling performance. Specifically, the ANFs aerogel separator-based batteries possess a discharge specific capacity of 102 mAh/g with a capacity retention of 90.7% and a Coulombic efficiency of 99.3% after 600 cycles at 5 C. In addition, under an operated temperature of 90 ℃, the battery with ANFs aerogel separator can still conduct the very steady charge-discharge, presenting a capacity retention of 90.1% and a Coulombic efficiency of 99.6% after 200 cycles at 3 C. Accordingly, the separator can probably serve as a potential candidate for application to advanced and safe LIBs.
The discovery of new perovskite compounds under high pressure mainly focuses on the ABO3 compositions and the compositions highly deviated from ABO3 are less explored. Here we demonstrate that the La6Sr3Si6O24 silicate composition can be stabilized as a hexagonal perovskite-related structure with isolated tetrahedra anions under high pressure of 6 GPa. The compound adopts 9-layer shifted hexagonal perovskite-like structure with both B-cation and oxygen deficiencies and contains pseudo-cubic (c′) (La/Sr)O2 layers and hexagonal (h) (La/Sr)O3 layers stacked according to (c′hh)3 sequence. This structure features both B-cation vacancy ordering between the two consecutive hexagonal layers and oxygen vacancy ordering in c′-(La/Sr)O2 layers, resulting in isolated tetrahedral SiO4 anions and ionic conduction behavior. This work demonstrates the practicability of accessing new perovskite-related functional materials from the compositions highly deviated from ABO3 under high pressure.
High residual concentration of arsenic and fluoride is a tricky problem to be solved in the process of reinjection after geothermal water utilization. We develop a method to simultaneously remove As(Ⅴ) and F− from geothermal water using magnetic Fe3O4@MgO adsorbent, fabricated via a one-step method. The effects of pH, contact time, adsorbent dose and temperature on the removal efficiency were investigated systematically. The results show that the Fe3O4@MgO composite has a wide range of pH (2–11), ultrafast removal dynamics (As(Ⅴ): 2 min; F−: 30 min), and high removal efficiency (As(Ⅴ): 99.9%; F−: 96.6%). The adsorption kinetics follows the pseudo-second-order kinetics model, and the adsorption isotherm model fits Freundlich. The adsorption capacity of As(Ⅴ) and F− can reach 123 and 98.4 mg/g, respectively. The exchange of As(Ⅴ) and F− with Mg-hydroxyl groups hydrolysis by MgO was determined the adsorption mechanism. The Fe3O4@MgO adsorbent was capable of achieving the adsorption efficiency as high as 99.9% for As(Ⅴ) and 97.3% for F− in real geothermal water, respectively. Hence, the proposed Fe3O4@MgO composite exhibited as an excellent adsorbent for the remediation of As- and F-contaminated geothermal water.
Tyrosine sulfation is an important post-translational modification that enhances the inhibitory activity of hirudin. Herein, we developed a facile synthetic strategy to afford the sulfated hirudins with up to three modifications and in multi-milligram scales, after a single HPLC purification step. Through these synthetic proteins, a novel type of modulation mechanism exhibited by tyrosine sulfation was proposed, which would help to delineate the structure–function relationships in other sulfated proteins and more importantly, to serve as a basis for the development of related antithrombotic agents.
Understanding the influence of sulfates over catalysts for selective catalytic reduction of NO with NH3 (NH3-SCR) is crucial due to the universal presence of SO2 in exhaust gas. Depending on the degree of sulfation, there mainly exist surface and bulk sulfates and NH3-SCR activity is generally considered to suffer more from bulk sulfates. Herein, the unique function of bulk sulfates over CeO2 in promoting high-temperature SCR reaction is revealed. Notably, compared with CeO2 dominated with surface sulfates (S-CeO2–4h) and commercial V2O5-WO3/TiO2, CeO2 with bulk sulfates (S-CeO2–72h) exhibits admirable NO conversion at the temperature range of 400–550 ℃. Bulk sulfates provide more Brønsted acid sites with stronger strength for NH3 adsorption. Moreover, the oxidation ability of CeO2 is significantly inhibited due to electron-withdrawing effect from bulk sulfates, which alleviates NH3 oxidation at high temperatures. More NH3 adsorption with high stability and limited NH3 oxidation capacity ensure the excellent catalytic performance for S-CeO2–72h in high-temperature denitration. This work provides new insight of bulk sulfates in promoting SCR activity and open a new avenue to design deNOx catalysts employed at high temperatures.
Comprehensive surgical staging or optimal tumor cytoreductive surgery of malignant ovarian cancer directly affects disease prognosis. Therefore, a fluorescent selenium nanoparticle (Se@RGD/S2.2) decorated with cancer-targeting Arg-Gly-Asp (RGD) peptides and GCAGTTGATCCTTTGGATACCCTGG aptamer (S2.2) was developed for use as a diagnostic agent to achieve rapid, noninvasive diagnosis and visualization of microinvasive lesions during surgery for malignant ovarian cancer.
Novel polyoxometalate (POM) Pickering interfacial catalyst (PIC) was fabricated through loading (NH4)5H6PMo4V8O40 (PMo4V8) on both alkyl and alkyl-amino groups functionalized silica nanoparticles. PMo4V8/SiO2(C8/C8NH2 with molar ratio as 1:1) PIC system provided a new catalytic model for aerobic conversion of 5-hydroxymethylfurfural (5-HMF), as well as its recovery and product separation in H2O/methyl isobutyl ketone (MIBK) biphase reaction. Balancing the ratio of PMo4V8, C8 and C8NH2 gave rise to variety in hydrophilicity and hydrophobicity for PMo4V8/SiO2(C8/C8NH2), which enhanced the transformation of 5-HMF to 2, 5-diformylfuran (DFF) in H2O/MIBK with 73.7% yield at 81.8% conversion than in H2O or MIBK single phase.
Two erbium(Ⅲ) complexes [ErCl(OArAd)3][Na(THF)6] (1) and Er(OArAd)3 (2) are successfully prepared by using one variety of "hard" base ligand with large steric hindrance. The coordination geometry around the Er(Ⅲ) site changes from distorted tetrahedral to flat trigonal pyramid geometry in different solvent environment due to the removal of the coordinated chloride. Such an alternation significantly enhances the single-molecule magnet (SMM) behavior and makes the field-induced effective energy barrier (Ueff) arrive at 43(1) cm−1 for the latter. Together with theoretical calculations, this study shows that strong equatorial ligand field and high local symmetry are critical to suppress the quantum tunneling of the magnetization (QTM) and achieve high-performance erbium(Ⅲ) based SMMs.
The integrated lipopeptide (RVA)/gene complexes are fabricated with bi-directional regulation on tumor cells and micro-environment. After self-assembling and target coating modification, the poly(γ-glutamic acid) (γ-PGA)/RVA nano-vectors can sequentially respond to pH & redox stimuli, and guarantee efficient therapeutic gene delivery and control release of all-trans retinoic acid. The design provides a facile but promising strategy to treat refractory cancers.
No. 86 Xueyuan South Road, Haidian District, Beijing
010-62199257
qkjq@cast.org.cn
Copyright © 2025 China Association for Science and Technology. All rights reserved. For all open access content, the relevant licensing terms apply.
Sponsored by the Office of the Leading Group for Cybersecurity and Informatization of CAST, and supported by Science and Technology Review Publishing House
