收藏切换
Silencing PTPN2 with nanoparticle-delivered small interfering RNA remodels tumor microenvironment to sensitize immunotherapy in hepatocellular carcinoma
收藏切换
PDF
Fu Wanga, b, Haoyu Youa, Huahua Liub, Zhuoran Qib, Xuan Shib, Zhiping Jinc, Qingyang Zhongb, Taotao Liub, Xizhong Shenb, Sergii Rudiukd, Jimin Zhub, *, Tao Suna, *, Chen Jianga
Acta Pharmaceutica Sinica B | 2025, 15(6) : 2915 - 2929
Less
收藏切换
Acta Pharmaceutica Sinica B | 2025, 15(6): 2915-2929
ORIGINAL ARTICLE
Silencing PTPN2 with nanoparticle-delivered small interfering RNA remodels tumor microenvironment to sensitize immunotherapy in hepatocellular carcinoma
Full
Fu Wanga, b, Haoyu Youa, Huahua Liub, Zhuoran Qib, Xuan Shib, Zhiping Jinc, Qingyang Zhongb, Taotao Liub, Xizhong Shenb, Sergii Rudiukd, Jimin Zhub, *, Tao Suna, *, Chen Jianga
Affiliations
  • aKey Laboratory of Smart Drug Delivery Ministry of Education, Minhang Hospital, State Key Laboratory of Medical Neurobiology and MOE Frontiers Center for Brain Science, Institutes of Brain Science, Department of Pharmaceutics, School of Pharmacy, Fudan University, Shanghai 201203, China
  • bDepartment of Gastroenterology and Hepatology and Shanghai Institute of Liver Diseases, Zhongshan Hospital, Fudan University, Shanghai 200032, China
  • cPharmacy Department, Zhongshan Hospital, Fudan University, Shanghai 200032, China
  • dPASTEUR, UMR8640, Department of Chemistry, PSL University, Sorbonne Université, CNRS, Ecole Normale Supérieure, Paris 75005, France
doi: 10.1016/j.apsb.2025.03.015
Outline
收藏切换

Protein tyrosine phosphatase nonreceptor type 2 (PTPN2) is a promising target for sensitizing solid tumors to immune checkpoint blockades. However, the highly polar active sites of PTPN2 hinder drug discovery efforts. Leveraging small interfering RNA (siRNA) technology, we developed a novel glutathione-responsive nano-platform HPssPT (HA/PEIss@siPtpn2) to silence PTPN2 and enhance immunotherapy efficacy in hepatocellular carcinoma (HCC). HPssPT showed potent transfection and favorable safety profiles. PTPN2 deficiency induced by HPssPT amplified the interferon γ signaling in HCC cells by increasing the phosphorylation of Janus-activated kinase 1 and signal transducer and activator of transcription 1, resulting in enhanced antigen presentation and T cell activation. The nano-platform was also able to promote the M1-like polarization of macrophages in vitro. The unique tropism of HPssPT towards tumor-associated macrophages, facilitated by hyaluronic acid coating and CD44 receptor targeting, allowed for simultaneous reprogramming of both tumor cells and tumor-associated macrophages, thereby synergistically reshaping tumor microenvironment to an immunostimulatory state. In HCC, colorectal cancer, and melanoma animal models, HPssPT monotherapy provoked robust antitumor immunity, thereby sensitizing tumors to PD-1 blockade, which provided new inspiration for siRNA-based drug discovery and tumor immunotherapy.

Immune checkpoint blockades  /  Liver cancer  /  Protein tyrosine phosphatase nonreceptor type 2  /  Type II interferon signaling  /  Tumor-associated macrophages  /  Tumor microenvironment
Fu Wang, Haoyu You, Huahua Liu, Zhuoran Qi, Xuan Shi, Zhiping Jin, Qingyang Zhong, Taotao Liu, Xizhong Shen, Sergii Rudiuk, Jimin Zhu, Tao Sun, Chen Jiang. Silencing PTPN2 with nanoparticle-delivered small interfering RNA remodels tumor microenvironment to sensitize immunotherapy in hepatocellular carcinoma[J]. Acta Pharmaceutica Sinica B, 2025 , 15 (6) : 2915 -2929 . DOI: 10.1016/j.apsb.2025.03.015
Hepatocellular carcinoma (HCC) comprises 75%–85% of primary liver cancer, ranking among the most prevalent and deadly malignancies worldwide1. While curative surgery is an option for patients diagnosed at an early stage, 40%–70% experience recurrence within 5 years, necessitating further treatment2. Emerging immunotherapies, such as immune checkpoint blockades (ICBs), have revolutionized the treatment paradigm for solid tumors. ICBs disrupt receptor–ligand interactions that suppress T cell activation or function, such as the PD-1 and CTLA-4 pathways3. Although substantial clinical benefits are observed in some patients, the overall objective response rate to ICBs in HCC remains below 20%, largely due to the immunosuppressive tumor microenvironment (TME)4,5. This limited efficacy underscores the urgent need for novel therapeutic strategies.
Protein tyrosine phosphatase nonreceptor type 2 (PTPN2) has emerged as a promising target for tumor immunotherapy6. It is a ubiquitously expressed protein tyrosine phosphatase that can dephosphorylate Janus-activated kinase 1 (JAK1) and signal transducer and activator of transcription 1 (STAT1) upon interferon (IFN) γ stimulation7,8. Phosphorylated STAT1 binds to the IFNγ activation site sequences, inducing the transcription of IFN-stimulated genes (ISGs) that encode numerous proteins to elicit antitumor effects, such as suppression of tumor cell proliferation and promotion of tumor antigen presentation9,10. Antigen presentation is essential for the activation of T cell-mediated adaptive immunity. Thus, this deficiency has been widely considered a critical reason for antitumor immunity injury and tumor immunotherapy resistance11,12. Preclinical studies in melanoma, colorectal, and breast cancers have shown that tumor cell-specific PTPN2 deletion markedly enhances immunotherapy efficacy by activating IFNγ-mediated growth suppression and antigen presentation, suggesting PTPN2 is a critical checkpoint target, but its role in HCC remains elusive13-15. Meanwhile, the highly polar active sites of PTPN2 have hindered drug discovery at the protein level16.
Small interfering RNA (siRNA) technology, a nucleic acid-based approach for gene silencing, offers significant advantages in efficacy, safety, and ease of preparation. However, the short half-life and instability under physiological conditions limit its applications17. A common strategy for protecting and delivering siRNA involves combining negatively charged siRNA with positively charged materials through electrostatic interactions. Classic cationic polymers used for this purpose include polyethyleneimine (PEI), polylysine, polyarginine, and dendritic polymers. Among these, PEI 25k is considered the gold standard for gene delivery, showing extremely high transfection efficiency in vitro18. However, the high molecular weight of PEI 25k impedes its metabolism and excretion, leading to in vivo accumulation and considerable physiological toxicity19. On the other hand, lower molecular weight PEI is more biocompatible but suffers from insufficient positive charge density, which restrains its gene compaction efficiency20. Consequently, there is an urgent need for a novel strategy to achieve both efficient gene editing and high biological safety.
Herein, we describe the discovery and preclinical characterization of HA/PEIss@si Ptpn2 (HPssPT), a novel nano-platform loaded with siPtpn2 that showed superior transfection efficiency compared with commercial reagents. PTPN2 deficiency induced by HPssPT potently sensitized HCC cells to IFNγ and enhanced the JAK-STAT pathway, increasing antigen presentation and T cell activation. Beyond its effects on tumor cells, HPssPT exhibited an affinity for multiple tumor microenvironment (TME) components, notably tumor-associated macrophages (TAMs), promoting their polarization towards an immune-activated M1-like phenotype. In well-defined mouse models, HPssPT exhibited excellent tolerance and significantly reduced tumor burden when combined with PD-1 blockade by reshaping the immunosuppressive TME. These findings provide new insights for siRNA-based drug discovery and tumor immunotherapy development.
Bis (sulfosuccinimidyl) 3,3′-dithiobis (propionate) (DTSSP) and agarose were purchased from Merck (Shanghai, China). Hyaluronic acid (HA, MW = 10,000) was obtained from Meilun Co., Ltd. (Dalian, China). Ethylenediamine branched PEI (MW = 800), O'RangeRuler 10 bp DNA ladder, and 6 × Orange DNA loading dye were acquired from Sigma–Aldrich (St. Louis, MO, USA). Dialysis bags (8000 MWCO) were sourced from Yuanye Co., Ltd. (Shanghai, China).
PEIss Synthesis: Equimolar amounts of PEI and DTSSP were reacted in an air shaker at 37 ℃ under argon protection for 48 h; the resulting solution was dialyzed against deionized water for 24 h using a dialysis bag with a molecular weight cutoff of 8000. The product, designated as PEIss, was obtained as a white flocculent substance after lyophilization. The structure of PEIss was characterized by one-dimensional proton nuclear magnetic resonance (Mercury Plus, Varian, CA, USA).
PssPT Preparation: Solutions of siPtpn2 (0.264 mg/mL) and PEIss (at various concentrations) were prepared in DEPC-treated water. Equal volumes of these solutions were mixed, vortexed for 30 s at room temperature (RT), and incubated in an ice bath for 30 min to obtain PssPT complexes. The optimal mass ratio of PEIss to siPtpn2 for efficient complexation was determined by agarose gel electrophoresis and dynamic light scattering (DLS) analysis (3600 Nano ZS, Malvern Panalytical, UK).
HPssPT Formulation: HA solutions of varying concentrations were prepared in DEPC-treated water. Equal volumes of HA and PssPT were mixed, vortexed for 30 s at RT, and left to stand in an ice bath for 30 min to obtain HPssPT nanoparticles. The optimal mass ratio of HA to PssPT was determined based on DLS (Malvern Panalytical) results.
A 10 μL aliquot of the prepared HPssPT solution was deposited onto a carbon-coated copper grid and absorbed for 1 min at RT. The excess solution was carefully removed from the edge of the grid using filter paper. Subsequently, the grid was inverted onto a 10 μL droplet of 3% uranyl acetate staining solution placed on the lid of a Petri dish and incubated for 1 min. The grid was then washed twice with deionized water and dried at RT. Transmission electron microscope imaging was performed to visualize the nanoparticle morphology.
The stability of HPssPT nanoparticles was assessed under physiologically relevant conditions. Equal volumes of freshly prepared HPssPT solution and 2 × phosphate-buffered saline (PBS) were mixed. The resulting solution was stored at 4 ℃, and the hydrodynamic diameter and zeta potential of the nanoparticles were monitored daily using DLS (Malvern Panalytical) and electrophoretic light scattering, respectively.
The GSH responsiveness of HPssPT nanoparticles was evaluated under simulated extracellular and intracellular redox conditions. Freshly prepared HPssPT solution was mixed in equal volumes with either 4 μmol/L or 20 mmol/L GSH solutions, representing extracellular and intracellular GSH concentrations, respectively. The mixtures were incubated at 37 ℃ with gentle agitation for 2 h. Changes in the hydrodynamic diameter of the nanoparticles were monitored using DLS (Malvern Panalytical) to assess the GSH-induced disassembly of the nanoparticles.
Murine Hepa1-6 HCC cells, B16–F10 melanoma cells (referred to as B16), CT26 colorectal cancer cells, Raw264.7 macrophages, bEnd.3 endothelial cells and NIH3T3 fibroblasts were obtained from the cell bank of the Chinese Academy of Science (Shanghai, China). Hepa1-6, B16, Raw264.7, bEnd.3, and NIH3T3 cells were cultured in Dulbecco's modified Eagle's medium (DMEM; HyClone, Logan, Utah, USA). CT26 cells were maintained in Roswell Park Memorial Institute (RPMI) 1640 medium (HyClone). All media were supplemented with 10% fetal bovine serum (FBS; Sigma–Aldrich, St. Louis, MO, USA). Cells were cultured at 37 ℃ in a humidified atmosphere containing 5% CO2 (Thermo Fisher Scientific, Waltham, MA, USA).
An orthotopic HCC mouse model was established using Hepa1-6 cells stably expressing Luciferase (Hepa1-6-Luc). HPssPT nanoparticles loaded with Cy5-labeled siRNA (0.825 mg/kg) were administered to the mice via tail vein injection. The biodistribution of the nanoparticles was monitored using the IVIS Spectrum CT small animal in vivo imaging system (PerkinElmer, MA, USA) at 6 h post-injection. Immediately following 24 h post-injection, mice were anesthetized and perfused. Major organs were then harvested and imaged ex vivo to quantify fluorescence intensity using the same imaging system.
Time-dependent uptake: Hepa1-6 cells were seeded at a density of 1.5 × 104 cells per well in a 96-well plate. Cells were treated with HPssPT nanoparticles loaded with Cy5-labeled siRNA at a constant dose for varying incubation periods time (0.5, 1, 2, 3, 4, 5, and 6 h). Following incubation, cells were harvested and analyzed using a CytoFLEX flow cytometer (Beckman Coulter, Brea, CA, USA). Data were processed using FlowJo software (Becton, Dickinson and Company, version 10.8.1).
Cell type-specific uptake: Hepa1-6, RAW264.7, bEnd.3, and NIH3T3 cells were seeded at a density of 1.5 × 104 cells per well in 96-well plates. Cells were treated with HPssPT nanoparticles loaded with FAM-labeled siRNA for 2 h. After incubation, cells were harvested and analyzed by flow cytometry as described above.
Hepa1-6 cells were seeded in 12-well plates at approximately 60% confluence. Cells were pre-treated with various endocytic inhibitors diluted in Hank's Balanced Salt Solution (HBSS): filipin (1 μg/mL), chlorpromazine (25 μg/mL), or colchicine (5 μg/mL). Following inhibitor treatment, cells were incubated with HPssPT nanoparticles loaded with FAM-labeled siRNA for 30 min. Cells were then harvested and analyzed by flow cytometry as described above.
Hepa1-6 cells were seeded at a density of 5 × 103 cells per well in confocal dishes. Cells were treated with HPssPT nanoparticles loaded with Cy3-labeled siRNA at a constant dose for various incubation periods (1, 2, 4, and 6 h). Following incubation, the cells were stained with Hoechst (5 μg/mL) and LysoTracker (50 nmol/L) for an additional 15 min, then washed with HBSS and imaged using a spinning disk confocal microscope to visualize the intracellular trafficking of HPssPT nanoparticles.
Cell Viability Assay: Hepa1-6 cells were seeded at a density of 5 × 103 cells per well in a 96-well plate. Cells were treated with HPssNC at various concentrations (0, 10, 25, 50, 100 nmol/L) for 24 h. Cell viability was determined using the Cell Counting Kit-8 (CCK8) Assay Kit (Beyotime, Shanghai, China) according to the manufacturer's protocol. Absorbance was measured at 450 nm using a microplate reader (Bio-Rad, Hercules, CA, USA).
Cell proliferation assay: Hepa1-6 cells were seeded at a density of 2 × 103 cells per well in a 96-well plate. Cells were treated with either HPssPT or HPssNC (both at 25 nmol/L) for various incubation times (0, 24, 48, and 72 h). Cell proliferation was evaluated using the CCK8 Assay Kit, and the absorbance was measured at 450 nm using a microplate reader.
Live/Dead Cell Staining: Hepa1-6 cells were seeded in a 6-well plate and incubated with either HPssPT or HPssNC (both at 25 nmol/L) for 24 h. Cells were then co-stained with Calcine AM and propidium iodide (PI) using a Live/Dead staining kit (KeyGEN Biotech, Nanjing, China) according to the manufacturer's protocol. Fluorescence images were photographed using fluorescence microscopy (Olympus, Tokyo, Japan).
Apoptosis assay: Hepa1-6 cells were seeded in 6-well plates and treated with either HPssPT or HPssNC (both at 25 nmol/L) for 24 h. Cells were then co-stained with Annexin V-FITC and PI using an Annexin V-FITC detection kit (BD Biosciences, San Jose, CA, USA) following the manufacturer's protocol. Stained cells were harvested and analyzed using flow cytometry, as described above.
To achieve PTPN2 knockdown, Hepa1-6 cells were transfected with siRNA targeting PTPN2 (siPtpn2) using Lipofectamine 3000 (Thermo Fisher Scientific). The siRNA: Lipofectamine 3000 ratio was maintained at 0.05% w/v. After 48 h of transfection, cells were harvested for quantitative reverse transcription PCR (qRT-PCR) and Western blot analysis to assess the knockdown efficiency of PTPN2. The sequence of siPtpn2 was as follows: 5′-CCAGCUUAGUUGACAUAGA-3′ (forward) and 5′-UCUAU GUCAACUAAGCUGG-3′ (reverse).
Total RNA was extracted from cells using RNAiso PLUS (Takara, Tokyo, Japan). Reverse transcription was conducted using an RT reagent Kit with gDNA Eraser (Takara, Tokyo, Japan) according to the manufacturer's instructions. Quantitative PCR was performed using SYBR Green (Yeason, Shanghai, China) on an ABI Prism 7500 Sequence Detection system (Applied Biosystems, Foster City, CA, USA). β-Actin was used as the housekeeping gene, and relative gene expression was calculated using the comparative ΔΔCT method. The sequences of primers designed were as follows. Ptpn2: GCAGTGAGAGCATTCTACGGA (forward) and TGACACAAACCCCATCTTAGTGA (reverse). H2-k1: ACCAGCAGTACGCCTACGA (forward) and AACCAGAACAGCAACGGTCG (reverse). H2-d1: TGGTGCTGCAGAGCATTACA (forward) and TGTGCCTTTGGGGAATCTGT (reverse). H2-i: GATGCAGAGCATTACAGGGC (forward) and GCCAGGTCAGGGCAATGTC (reverse). Tap1: GGACTTGCCTTGTTCCGAGAG (forward) and CAGCATCCGACACAGCATGT (reverse). β-Actin: GGCTGTATTCCCCTCCATCG (forward) and CCAGTTGGTAACAATGCCATGT (reverse).
Western blot analysis was performed as previously described21. Briefly, cells were lysed in RIPA buffer (Beyotime) supplemented with 1% phenylmethylsulfonyl fluoride, protease, and phosphatase inhibitor cocktail (Beyotime). Equal amounts of protein were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes (Millipore, Burlington, MA, USA). The membrane was then incubated with primary antibodies against the following proteins: PTPN2 (1:2000), JAK1 (1:2000), p-JAK1 (1:2000), STAT1 (1:2000), p-STAT1 (1:2000; all from Cell Signaling Technology, Danvers, MA, USA), or Vinculin (1:2000; Abclonal, Wuhan, China). Following incubation with a secondary antibody, protein bands were visualized using a Tanon-5200 Chemiluminescent Image System (Tanon, Shanghai, China) for imaging.
CD8+ T cells were isolated from OT-I mouse splenocytes using magnetic separation (BioLegend, San Diego, CA, USA). The isolated T cells were then stimulated with plate-bound anti-CD3 (2.5 μg/mL) and anti-CD28 (2.5 μg/mL) antibodies (BioXcell, Lebanon, NH, USA). Hepa1-6 cells were transfected with SIINFEKL-expressing plasmid using Lipofectamine 3000 according to the manufacturer's protocol. The transfected Hepa1-6 cells were then treated with either HPssNC or HPssPT (both at 25 nmol/L) in the presence of IFNγ (100 ng/mL) for 24 h. Subsequently, these treated Hepa1-6 cells were co-cultured with the stimulated OT-I CD8+ T cells at a ratio of 1:1 for 48 h.
RNA-Seq Data Analysis: RNA-seq data were obtained from The Cancer Genome Atlas (TCGA) database (https://www.cancer.gov/tcga) to generate CD44 expression profiles across various solid tumors, including colorectal adenocarcinoma (COAD), rectal adenocarcinoma (READ), liver hepatocellular carcinoma (LIHC), stomach adenocarcinoma (STAD), thyroid carcinoma (THCA), kidney renal clear cell carcinoma (KIRC), kidney chromophobe (KICH), and ovarian serous cystadenocarcinoma (OV).
Single-cell RNA (scRNA)-seq data analysis: scRNA-seq data were obtained from the Gene Expression Omnibus (GEO) database (accession number: GSE202642), comprising 7 HCC and 4 adjacent non-tumor samples. Data analysis was performed using the Seurat package (version 4.3.1) in R software. Genes with a normalized expression between 0.125 and 3 and a quantile-normalized variance exceeding 0.5 were considered highly variable. Dimensionality reduction was performed using Uniform manifold approximation and projection (UMAP) and t-distributed stochastic neighbor embedding (t-SNE). Known biological cell types were identified using canonical marker genes and putative CNV signals, as previously described22.
Bone marrow cells were extracted from tibias and femurs of 6-week-old male C57BL/6 wild-type mice. Following isolation, red blood cells were lysed using a standard lysis buffer. The remaining cells were cultured in DMEM supplemented with 10% FBS and 50 ng/mL recombinant mouse macrophage colony-stimulating factor (M-CSF; Novoprotein, Suzhou, China). The culture medium was replenished on Day 2. On Day 6, interleukin-4 (IL-4; Novoprotein) was added to the medium to induce M2 polarization. The macrophage differentiation and polarization process were completed on Day 8.
For in vitro experiments, cells were harvested via trypsinization, re-suspended in PBS, and stained with the following antibodies: APC anti-mouse H2K(b) bound to SIINFEKL (1:200; BioLegend), APC anti-mouse H2K(b)/H2D(b) (1:200; BioLegend), PE anti-mouse IFNγ (1:200; BD Biosciences), and FITC anti-mouse MHC-II (1:200; BioLegend).
For in vivo experiments, fresh tumor tissues were digested with collagenase IV (1 mg/mL; Sigma–Aldrich) and DNase I (1 × 10−3 U/L; Invitrogen, Carlsbad, CA, USA). Tumor-infiltrating lymphocytes were isolated by gradient centrifugation using Percoll (Yeason). Isolated cells were stained with the following antibodies: Live&Dead-Fluor506 (1:1000; Invitrogen), BUV395 anti-mouse CD45 (1:250; BD Biosciences), PE Cy7 anti-mouse CD3 (1:250; BioLegend), Fluor450 CD4 (1:250; BD Biosciences), PerCP Cy5.5 anti-mouse CD8 (1:250; BD Biosciences), PE anti-mouse IFNγ (1:250; BD Biosciences), PerCP Cy5.5 anti-mouse CD11b (1:250; BioLegend), APC anti-mouse Gr-1 (1:250; BioLegend), PE anti-mouse F4/80 (1:250; BioLegend), and FITC anti-mouse MHC-II (1:250; BioLegend). Stained cells were analyzed using a CytoFLEX flow cytometer. Data were processed using the FlowJo software.
Tumor tissues were fixed in 4% paraformaldehyde and embedded in paraffin. Sections were then deparaffinized and rehydrated following standard protocols. Heat-induced epitope retrieval was performed by immersing the specimens in 10 mmol/L sodium citrate buffer (pH 6.0) and boiling for 10 min. Specimens were blocked with 10% serum at RT for 30 min and then incubated overnight at 4 ℃ with primary antibodies: anti-CD8α (1:100; Abcam, Boston, MA, USA) and anti-granzyme B (1:100; Abcam). The following day, specimens were incubated with HRP-conjugated secondary antibodies at RT for 60 min. Nuclei were counterstained with DAPI. Stained sections were examined using a fluorescence microscope (Olympus, Tokyo, Japan) at the appropriate excitation wavelengths for each fluorophore.
All animal experiments were conducted in accordance with guidelines evaluated and approved by the Institutional Animal Care and Use Committee of Zhongshan Hospital, Fudan University. Male C57BL/6 mice and BALB/c wild-type mice (6 weeks old) were purchased from Biocytogen (Shanghai, China). OT-I mice were kindly gifted by Dr. Yikun Yao at the Chinese Academy of Science (Shanghai, China).
To establish the HCC orthotopic mouse model, about 1 × 106 Hepa1-6 cells were suspended in 150 μL PBS and injected subcutaneously into the right flank of C57BL/6 mice. After two weeks, the mice were euthanized, and the subcutaneous tumors were excised, cut into 1 mm3 cubes, and implanted into the liver lobe of new C57BL/6 mice under anesthesia. At the study endpoint, orthotopic tumors and major organs, including the heart, lung, liver, kidney, spleen, and intestine, were harvested for further analysis. Organ samples were fixed in 4% paraformaldehyde, paraffin-embedded, sectioned, and stained with hematoxylin and eosin (H&E). Pulmonary metastases were evaluated microscopically by two experienced pathologists.
For the xenograft mouse model, about 1 × 106 cells of B16 or CT26 were suspended in 150 μL PBS and injected subcutaneously into the right flank of C57BL/6 or BALB/c mice, respectively. Tumor volume was measured every 3 days using Eq. (1):
At the endpoint, subcutaneous tumors were harvested for further analysis.
For drug intervention studies, HPssNC (0.8 mg/kg, i.v.), HPssPT (0.8 mg/kg, i.v.), and anti-PD-1 antibody (5 mg/kg, i.p.; Biolegend) were administered twice weekly, either alone or in combination. Sterile PBS and isotype IgG2 served as vehicle controls.
Statistical analyses were performed using GraphPad Prism software (version 9.0). Data are presented as means ± standard deviation (SD). Two-group comparisons were analyzed using unpaired Student's t-tests. For comparisons among multiple groups, a one-way analysis of variance (ANOVA) was performed, followed by Tukey's honestly significant difference (HSD) post-hoc test. Statistical significance was set at P < 0.05.
The cationic network polymer PEIss was synthesized by crosslinking PEI with GSH-responsive linkers, as confirmed by nuclear magnetic resonance spectroscopy (Fig. 1A and Supporting Information Fig. S1A). Agarose gel electrophoresis experiments were conducted to assess the gene loading capacity of PEIss. Results showed complete compression of siRNA at a 5:1 mass ratio of PEIss to siRNA (Fig. 1B). A ratio of 6:1 was chosen for further formulation optimization to prevent potential gene leakage.
To improve the in vivo fate of the positively charged nanocore PssPT and prevent potential aggregation caused by negatively charged substance adsorption, PssPT was coated with a layer of negatively charged, biodegradable hyaluronic acid (HA). This formulation was designated as HA/PEIss@siPtpn2 (abbreviated as HPssPT; Fig. 1A). As HA content increased, the surface charge flipped from positive to negative, stabilizing at a ratio of HA:PEIss:siRNA of 15:6:1 (w/w/w), indicating whole encapsulation of PssPT by HA (Fig. 1C and Fig. S1B). Based on particle size and zeta potential analyses, the ratio of 15:6:1 was selected as the final formulation (Fig. 1D and Fig. S1C).
TEM revealed that HPssPT was uniformly sized, well-formed spheres with a diameter of approximately 180 nm and a zeta potential of approximately −22.3 mV (Fig. 1E‒G). The particle size and polydispersity index of HPssPT stabilized in PBS solution at 4 ℃ for 7 days, demonstrating excellent in vitro stability (Fig. 1H).
To investigate the GSH responsiveness of HPssPT, GSH solutions of 2 μmol/L and 10 mmol/L were used to simulate the extracellular and intracellular GSH environments, respectively. HPssPT particle size remained unchanged in the 2 μmol/L GSH solution but rapidly disintegrated in the 10 mmol/L GSH solution, suggesting superior intracellular GSH responsiveness (Fig. 1I). Collectively, a novel siRNA delivery nano-platform, HPssPT, was developed based on HA, PEI, and disulfide-containing linkers. The internal disulfide bonds of HPssPT were designed to break under high intracellular GSH levels, leading to nanoparticle disintegration and substantial siRNA release, potentially eliciting a potent gene-silencing effect in target cells.
To investigate the potential mechanism of cell uptake, tumor cells were treated with HPssPT and various uptake pathway inhibitors. Flow cytometry analysis revealed significant inhibition of cell uptake at 4 ℃ and with chlorpromazine treatment, suggesting an energy-dependent and clathrin-mediated endocytosis mechanism for HPssPT (Fig. 2A). This implies that HPssPT likely enters the lysosome before escaping into the cytoplasm. A time-dependent pattern of cell uptake was observed, with uptake reaching saturation after a 5-h incubation (Fig. 2B).
Confocal microscopy studies using Cy3-labeled HPssPT and Lysotracker staining revealed the intracellular trafficking of nanoparticles. After 1 h, minimal uptake was observed with no colocalization in lysosomes. Significant colocalization and cytoplasmic presence were noted after 2 h. At 4 h, substantial colocalization persisted, with some particle escape evident. By 6 h, colocalization decreased markedly, indicating predominant lysosomal escape (Fig. 2C). These results demonstrate that HPssPT can enter the cytoplasm via lysosomal escape and subsequently disintegrate, releasing siRNA under high intracellular GSH concentrations.
To assess PTPN2 inhibition efficiency and determine the optimal concentration, HCC cells were treated with 10, 25, or 50 nmol/L siRNA using HPssPT or a commercial reagent. HPssPT significantly attenuated the mRNA and protein expression of PTPN2 in HCC cells, displaying superior transfection capacity than Lipofectamine 3000, particularly at low siRNA concentrations (Fig. 2D and E). No enhanced transfection capacity was observed between 25 and 50 nmol/L; therefore, 25 nmol/L was identified as the working concentration for subsequent studies.
Next, the cytotoxicity of HPssPT was evaluated. To avoid the impact of PTPN2 inhibition, siRNA with the chaotic sequence was utilized as negative control (siNC). HA/PEIss@siNC (HPssNC) at various concentrations revealed no significant changes in cell viability (Fig. 2F). PTPN2, the target of HPssPT, is known as a potential therapeutic target for regulating tumor-immune cell interactions. Still, its intrinsic role in tumor cell growth remains uncertain. Cell proliferation assay was conducted to explore the “immunity-independent” effect of HPssPT, and no impact of HPssPT on cell proliferation was observed within 3 days (Fig. 2G). Live/Dead cell staining corroborated the absence of cell death induction by HPssPT (Fig. 2H). Flow cytometry analysis of apoptosis markers demonstrated no significant early apoptosis (Annexin V+/PI), later apoptosis (Annexin V+/PI+), or other nonapoptotic cell death (Annexin V/PI+), with no notable difference in live cell ratios (Annexin V/PI) between HPssPT and HPssNC groups (Fig. 2I). These findings suggest that HPssPT exhibits exceptional transfection efficiency and excellent safety performance in vitro, with no direct impact on cell viability by targeting PTPN2.
Genetic ablation of PTPN2 in tumor cells has been shown to enhance the phosphorylation of JAK1 and STAT1, augmenting downstream IFNγ responses, including cell growth suppression, antigen presentation, and T cell stimulation6 (Fig. 3A). Therefore, the effect of HPssPT on the IFNγ signal transduction was investigated.
PTPN2 inhibition by HPssPT promoted the phosphorylation of JAK1 and STAT1 in HCC cells under IFNγ treatment (Fig. 3B). Notably, cells did not exhibit increased JAK1 and STAT1 phosphorylation without IFNγ treatment, suggesting that HPssPT does not spontaneously activate the IFNγ signaling (Fig. 3B). Consistently, HPssPT treatment significantly enhanced downstream IFNγ responses, such as IFNγ-driven growth suppression in vitro (Fig. 3C). It also led to increased expression of IFNγ-induced genes for antigen presentation via major histocompatibility complex class I (MHC-I; Fig. 3D). Consistently, cells treated with HPssPT and IFNγ had increased membrane MHC-I expression compared with control-treated cells (Fig. 3E).
To confirm the improved antigen presentation by PTPN2 inhibition, the exogenous protein ovalbumin (OVA) in HCC cells was expressed. Flow cytometry analysis showed increased mean fluorescence intensity (MFI) of the OVA-derived SIINFEKL epitope presented by MHC-I (H2-Kb) on cells treated with HPssPT and IFNγ, suggesting that PTPN2 inhibition in HCC cells after IFNγ stimulation promoted functional antigen-loaded MHC-I (Fig. 3F). To explore whether PTPN2 inhibition by HPssPT enhances T cell recognition, OVA-expressing HCC cells were co-cultured with OT-I CD8+ T cells, which specifically recognize the SIINFEKL epitope (Fig. 3G). Pretreatment of OVA-expressing HCC cells with HPssPT and IFNγ enhanced CD8+ T cell activation status, as evidenced by increased intracellular IFNγ production (Fig. 3H). Taken together, HPssPT treatment in vitro sensitizes tumor cells to IFNγ, increasing antigen presentation and potentiating T cell activation.
CD44, the major surface receptor for HA23, may determine the tumor-targeting ability of HPssPT. Analysis of the TCGA database revealed generally elevated CD44 expression in tumor tissues compared to peritumor tissues across multiple cancers (Supporting Information Fig. S2). Furthermore, scRNA-seq analysis of the GEO database indicated CD44 expression not only on tumor cells but also on immune cells, endothelial cells, and fibroblasts, indicating potential affinity of HPssPT for multiple components in the TME (Fig. 4A and B). Quantitative analysis revealed relatively higher CD44 expression in CD8+ T cells and macrophages (Fig. 4C and D). HPssPT remarkably inhibited PTPN2 expression in mouse bone marrow-derived macrophages (BMDMs), possibly due to their potent phagocytic capacity (Fig. 4E). However, no significant siRNA transfection effects were observed in CD8+ T cells (Supporting Information Fig. S3). Cell uptake assays in CD44-expressed cells showed that tumor cells (Hepa1-6) had higher uptake efficiency than endothelial cells (bEnd.3) and fibroblasts (NIH3T3), indicating preferential uptake of HPssPT by tumor cells (Fig. 4F). Additionally, macrophages (Raw264.7) also exhibited high uptake efficiency, consistent with the notably decreased PTPN2 expression in HPssPT-treated macrophages (Fig. 4F).
TAMs, which tend to exert an immunosuppressive M2-like phenotype, are predominant immunocytes in HCC and potential therapeutic targets due to their phenotype plasticity24. To explore the effect of HPssPT on macrophage function, the expression of M1 and M2 gene markers was investigated in BMDMs pre-treated with IL-4. HPssPT treatment considerably increased the mRNA expression of M1 markers (Inos, Cxcl9, and Cxcl10) and decreased the mRNA expression of M2 markers (Arg1 and Mrc1) in the M2-like BMDMs (Fig. 4G). It also notably promoted the previously inhibited antigen-presenting function of M2-like BMDMs, as measured by MHC-II expression levels (Fig. 4H). In conclusion, macrophages are susceptible to HPssPT, which can induce immune activation upon HPssPT treatment. These findings suggest that HPssPT may have potential applications in reprogramming the immunosuppressive TME, particularly through its effects on macrophages.
Prior to exploring in vivo efficacy, the distribution of HPssPT was investigated in orthotopic HCC-bearing nude mice using Cy5-labeled HPssPT. After 6 h, a pronounced accumulation of HPssPT was observed in d-luciferase pre-labeled tumors (Supporting Information Fig. S4A). Ex vivo organ analysis at 24 h displayed a maximum accumulation of HPssPT at the tumor site, except the metabolic organs like the kidneys and liver, suggesting HPssPT's excellent capability to reach and continuously accumulate at the tumor site for an extended period (Fig. S4B and S4C). Meanwhile, besides the tumor, a general distribution of HPssPT across various organs was observed, which was likely due to the wide expression of CD44 in various tissues. Among them, there was a maximum accumulation of HPssPT in the metabolic organs, especially the kidneys, suggesting that they might be the major metabolic and excreted organs of HPssPT.
To investigate the antitumor capacity of HPssPT and whether it could inflame the TME in vivo, orthotopic HCC mouse models were established and treated with: 1) IgG, 2) IgG plus HPssNC, 3) IgG plus HPssPT, 4) anti-PD-1, 5) anti-PD-1 plus HPssNC, or 6) anti-PD-1 plus HPssPT (Fig. 5A). Moderate tumor growth suppression and lung metastasis restriction were observed for HPssPT or anti-PD-1 monotherapy, while the combination therapy of HPssPT and anti-PD-1 significantly inhibited tumor growth and lung metastasis (Fig. 5B‒E). Besides, the combination therapy or HPssPT monotherapy was well-tolerated by mice, as shown by stable weight growth and unchanged indices of hepatic and renal function compared with untreated mice (Supporting Information Fig. S5A and S5B). H&E staining of major organs confirmed no systemic damage after treatment with HPssPT alone or combined with anti-PD-1 (Fig. S5C).
Flow cytometry analysis revealed that both HPssPT monotherapy and the combination with anti-PD-1 significantly stimulated the infiltration of MHC-II+ TAMs compared with control groups (Fig. 5F, Supporting Information Fig. S6A and S6B). Analysis of tumor-infiltrating lymphocytes spotted a pronounced enhancement in intratumor infiltration of CD4+ and CD8+ T cells in mice treated with HPssPT (Fig. S6C and S6D). However, no obvious differences in tumor-infiltrating CD4+ and CD8+ T cells were observed among mice receiving anti-PD-1 antibodies with or without HPssPT, suggesting that the maximum of T cell infiltrating might have been reached due to anti-PD-1 therapy (Fig. S6D). As mentioned before, HPssPT treatment potentiated T cell activation by increasing intracellular IFNγ production in vitro. Consistently, HPssPT treatment with or without anti-PD-1 also notably increased intracellular IFNγ production in tumor-infiltrating CD4+ and CD8+ T cells (Fig. 5G and H, Fig. S6E and S6F). Additionally, the number of cytotoxic T cells increased the most under the combination treatment compared to other groups, and HPssPT monotherapy also enhanced the infiltrating of cytotoxic T cells, suggesting an immune-activated TME induced by HPssPT (Fig. 5I). Furthermore, HPssPT treatment was applied in other immunotherapy-resisted tumors, including colorectal cancer and melanoma. As expected, HPssPT also showed successful synergy with anti-PD-1 in suppressing the growth of colorectal tumors (Supporting Information Fig. S7A‒S7C) and melanoma (Fig. S7D‒S7F) and remarkably inflamed the melanoma TME, characterized by enhanced cytokine production and increased cytotoxic T cell infiltration (Fig. S7G and S7H). Overall, these data further support PTPN2's role in remodeling the TME from an immunosuppressive state to an immunostimulatory state, thus enhancing immunotherapy response in immunotherapy-resisted tumors.
Immunotherapy for HCC is promising yet particularly challenging due to the unsatisfactory response rate, which is associated with the quantity and quality of immune cells within TME25-27. Herein, this study presents the design and application of a novel siRNA delivery nano-platform, HPssPT, for delivering siRNA targeting the protein tyrosine phosphatase PTPN2 to sensitize solid cancers to immunotherapy. The key findings demonstrate the potent transfection efficiency of HPssPT in delivering siRNA to tumor cells and TAMs, leading to pronounced antitumor immunity and remodeling of the immunosuppressive TME.
Based on the previous research on gene delivery systems28-30, we developed HPssPT, a novel nano-platform loaded with siPtpn2 that was created by crosslinking low molecular weight PEI into a network and frangible polymer via disulfide linkers with functional groups at both ends. The nano-platform was characterized by a high positive charge density, which facilitated the protection and delivery of siRNA. Upon cellular entry, HPssPT rapidly disintegrates due to the diminished electrostatic interactions triggered by the cleavage of disulfide linkers by specific reactive groups. Thereby, HPssPT showed outstanding transfection efficiency compared with market reagents.
PTPN2 has previously been reported to regulate multiple immune responses as well as immune cell differentiation and to increase the production of cytokines, including IFNγ, TNF, and IL-17 in mice31,32. In our study, PTPN2 inhibition by HPssPT amplified IFNγ signaling in tumor cells, as evidenced by increased phosphorylation of JAK1 and STAT1 upon IFNγ stimulation. Phosphorylated STAT1 binds to the IFNγ activation site sequences, inducing the transcription of IFN-stimulated genes that encode numerous proteins to elicit antitumor effects, such as suppression of tumor cell proliferation and activation of T cell function via increased MHC expression9,10. Consistently, HPssPT treatment enhanced IFNγ-driven HCC growth suppression and promoted MHC-I-dependent antigen presentation in HCC cells. Furthermore, the increased antigen-presenting capacity prompted a more activated T cell effector function, such as IFNγ production, which in turn amplified the HPssPT effect via a positive feedback loop involving the IFNγ signaling pathway. These findings corroborate previous reports highlighting the tumor cell-intrinsic role of PTPN2 as a negative regulator of IFNγ responsiveness and antitumor immunity33. Notably, HPssPT did not spontaneously activate the IFNγ pathway in the absence of exogenous IFNγ, suggesting that PTPN2 inhibition alone is insufficient to trigger IFNγ signaling and requires an additional inflammatory stimulus.
Beyond its direct effects on tumor cells, HPssPT also targeted TAMs within the TME. TAMs constitute a significant component of the immunosuppressive TME and tend to exhibit an M2-like phenotype that supports tumor progression and immune evasion34,35. Remarkably, HPssPT treatment reprogrammed TAMs towards an immunostimulatory M1-like phenotype, characterized by increased expression of M1 markers, decreased M2 marker expression, and enhanced antigen-presenting capacity via upregulation of MHC-II. This repolarization of TAMs likely contributed to the remodeling of the immunosuppressive TME observed upon HPssPT treatment, promoting an inflammatory and immune-activated state conducive to T cell infiltration and antitumor immunity.
In the HCC, colorectal cancer, and melanoma animal models, HPssPT monotherapy exhibited moderate antitumor activity, while its combination with anti-PD-1 blockade resulted in significant tumor growth inhibition. These findings are consistent with previous studies demonstrating that PTPN2 deletion enhances the efficacy of immunotherapy in melanoma, colorectal, and breast cancers6,13,36. The combination therapy was well-tolerated, highlighting the safety profile of HPssPT. Mechanistically, HPssPT treatment promoted infiltration of MHC-II+ TAMs and CD4+/CD8+ T cells into the tumor, with a pronounced increase in intracellular IFNγ production by T cells, indicating an enhanced effector function. Moreover, the combination therapy led to a remarkable increase in the number of cytotoxic T cells within the TME, suggesting a potent antitumor immune response. The broad applicability of HPssPT was further demonstrated in melanoma and colorectal cancer models, where it synergized with anti-PD-1 therapy to suppress tumor growth and inflame the TME, characterized by increased cytokine production and cytotoxic T cell infiltration. These findings suggest that PTPN2 inhibition by HPssPT may represent a promising combination strategy to overcome resistance to immunotherapy across multiple tumors. Notably, previous studies have reported that PTPN2 deletion in cancer cells can enhance antitumor immunity by activating IFNγ-mediated effects on growth suppression and antigen presentation37,38. However, the highly polar active sites of PTPN2 have hindered drug discovery efforts at the protein level16. The siRNA-based approach employed by HPssPT circumvents this limitation, enabling precise and effective inhibition of PTPN2 in both tumor cells and TAMs.
A unique aspect of the HPssPT nano-platform is its ability to target multiple components of the TME, facilitated by the HA coating and the widespread expression of the HA receptor CD4439. Notably, HPssPT exhibited a remarkable tropism towards TAMs, which are known to express high levels of CD4440,41. By simultaneously reprogramming both tumor cells and TAMs, HPssPT was able to synergistically remodel the TME to an immunostimulatory state, thereby sensitizing tumors to immunotherapy. This dual-targeting approach may offer advantages over strategies that solely focus on modulating tumor cells or immunocytes, as it addresses the complex interplay between these components within the TME.
Although we observed the accumulation of HPssPT in the tumor site and verified the outstanding RNA interfering capability of HPssPT in HCC cells and TAMs, the reason why HPssPT had no impact on CD8+ T cells and the susceptibility of HPssPT to other immunocytes remains to be clarified. Especially previous studies have reported that PTPN2 deletion in T cells and dendritic cells may result in increased immune activation42-44. Hence, a PTPN2-targeted therapy may induce multiple antitumor mechanisms by acting on varied components in TME, revealing the immense potential of the therapeutic target of PTPN2 and directing future studies on HPssPT.
It is worth noting that while HPssPT monotherapy exhibited moderate antitumor activity, the most profound therapeutic benefit was achieved in combination with anti-PD-1 blockade. This observation aligns with the proposed mechanism of action, wherein PTPN2 inhibition by HPssPT potentiates the IFNγ signaling, antigen presentation, and T cell activation, thereby enhancing the sensitivity of tumors to immune checkpoint inhibitors. Notably, the combination therapy was well-tolerated, suggesting that the potential toxicities associated with systemic PTPN2 inhibition may be mitigated by the targeted delivery approach employed by HPssPT.
In summary, our study provides compelling evidence for the pivotal role of PTPN2 in orchestrating an immunosuppressive TME and highlights the therapeutic potential of targeting PTPN2 to sensitize tumors to immunotherapy. We developed a novel system for siRNA delivery based on electrostatic complexes of siRNA with disulfide-crosslinked short PEI covered with hyaluronic acid and successfully overcame the challenges associated with targeting undruggable proteins like PTPN2, leveraging the specificity and potency of siRNA-mediated gene silencing. Moreover, the unique tropism of HPssPT towards TAMs, facilitated by the HA coating and CD44 receptor targeting, allowed for simultaneous reprogramming of both tumor cells and TAMs, thereby synergistically remodeling the TME to an immunostimulatory state. This study provides a strong rationale for pursuing PTPN2 inhibition as a combination strategy to enhance the efficacy of cancer immunotherapy and paves the way for future translational efforts in this domain.
1.
Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2021;71:209—49.
2.
Zhou J, Sun HC, Wang Z, Cong WM, Wang JH, Zeng MS, et al. Guidelines for the diagnosis and treatment of hepatocellular carcinoma (2019 edition). Liver Cancer 2020;9:682—720.
3.
Topalian SL, Drake CG, Pardoll DM. Immune checkpoint blockade: a common denominator approach to cancer therapy. Cancer Cell 2015;27:450—61.
4.
El-Khoueiry AB, Sangro B, Yau T, Crocenzi TS, Kudo M, Hsu C, et al. Nivolumab in patients with advanced hepatocellular carcinoma (CheckMate 040): an open-label, non-comparative, phase 1/2 dose escalation and expansion trial. Lancet 2017;389:2492—502.
5.
Finn RS, Ryoo BY, Merle P, Kudo M, Bouattour M, Lim HY, et al. Pembrolizumab as second-line therapy in patients with advanced hepatocellular carcinoma in KEYNOTE-240: a randomized, double-blind, phase III trial. J Clin Oncol 2020;38:193—202.
6.
Manguso RT, Pope HW, Zimmer MD, Brown FD, Yates KB, Miller BC, et al. In vivo CRISPR screening identifies PTPN2 as a cancer immunotherapy target. Nature 2017;547:413—8.
7.
Kleppe M, Soulier J, Asnafi V, Mentens N, Hornakova T, Knoops L, et al. PTPN2 negatively regulates oncogenic JAK1 in T-cell acute lymphoblastic leukemia. Blood 2011;117:7090—8.
8.
Pike KA, Tremblay ML. TC-PTP and PTP1B: regulating JAK-STAT signaling, controlling lymphoid malignancies. Cytokine 2016;82:52—7.
9.
Decker T, Kovarik P, Meinke A. GAS elements: a few nucleotides with a major impact on cytokine-induced gene expression. J Interferon Cytokine Res 1997;17:121—34.
10.
Ivashkiv LB. IFNgamma: signalling, epigenetics and roles in immunity, metabolism, disease and cancer immunotherapy. Nat Rev Immunol 2018;18:545—58.
11.
Pishesha N, Harmand TJ, Ploegh HL. A guide to antigen processing and presentation. Nat Rev Immunol 2022;22:751—64.
12.
Reeves E, James E. Antigen processing and immune regulation in the response to tumours. Immunology 2017;150:16—24.
13.
Goh PK, Wiede F, Zeissig MN, Britt KL, Liang S, Molloy T, et al. PTPN2 elicits cell autonomous and non-cell autonomous effects on antitumor immunity in triple-negative breast cancer. Sci Adv 2022;8:eabk3338.
14.
Katkeviciute E, Hering L, Montalban-Arques A, Busenhart P, Schwarzfischer M, Manzini R, et al. Protein tyrosine phosphatase nonreceptor type 2 controls colorectal cancer development. J Clin Investig 2021;131:e140281.
15.
LaFleur MW, Nguyen TH, Coxe MA, Miller BC, Yates KB, Gillis JE, et al. PTPN2 regulates the generation of exhausted CD8(+) T cell subpopulations and restrains tumor immunity. Nat Immunol 2019;20:1335—47.
16.
Mullard A. Phosphatases start shedding their stigma of undruggability. Nat Rev Drug Discov 2018;17:847—9.
17.
de Brito ECD, Frederico ABT, Azamor T, Melgaco JG, da Costa Neves PC, Bom A, et al. Biotechnological evolution of siRNA molecules: from bench tool to the refined drug. Pharmaceuticals 2022;15.
18.
Yin H, Kanasty RL, Eltoukhy AA, Vegas AJ, Dorkin JR, Anderson DG. Non-viral vectors for gene-based therapy. Nat Rev Genet 2014;15:541—55.
19.
Liu HM, Liu CY, Ye L, Ma D, He XZ, Tang QY, et al. Nanoassemblies with effective serum tolerance capability achieving robust gene silencing efficacy for breast cancer gene therapy. Adv Mater 2021;33:2003523.
20.
Liu WJ, Cao JP, Ma CC, Zhou H, Guo TY. Zinc(II)-quinoline module and ROS cleavable crosslinker functionalized self-fluorescent siRNA vectors for selective gene silencing of cancer cells. J Control Release 2024;366:366—74.
21.
Wang F, Xu WQ, Zhang WQ, Xu RC, Sun JL, Zhang GC, et al. Transferrin receptor 1 promotes hepatocellular carcinoma progression and metastasis by activating the mTOR signaling pathway. Hepatol Int 2023;18:636—50.
22.
Zhu GQ, Tang Z, Huang R, Qu WF, Fang Y, Yang R, et al. CD36(+) cancer-associated fibroblasts provide immunosuppressive microenvironment for hepatocellular carcinoma via secretion of macrophage migration inhibitory factor. Cell Discov 2023;9:25.
23.
Aruffo A, Stamenkovic I, Melnick M, Underhill CB, Seed B. CD44 is the principal cell surface receptor for hyaluronate. Cell 1990;61:1303—13.
24.
Sprinzl MF, Reisinger F, Puschnik A, Ringelhan M, Ackermann K, Hartmann D, et al. Sorafenib perpetuates cellular anticancer effector functions by modulating the crosstalk between macrophages and natural killer cells. Hepatology 2013;57:2358—68.
25.
Li Q, Han JJ, Yang YL, Chen Y. PD-1/PD-L1 checkpoint inhibitors in advanced hepatocellular carcinoma immunotherapy. Front Immunol 2022;13:1070961.
26.
Paijens ST, Vledder A, de Bruyn M, Nijman HW. Tumor-infiltrating lymphocytes in the immunotherapy era. Cell Mol Immunol 2021;18:842—59.
27.
Rimassa L, Finn RS, Sangro B. Combination immunotherapy for hepatocellular carcinoma. J Hepatol 2023;79:506—15.
28.
An S, He D, Wagner E, Jiang C. Peptide-like polymers exerting effective glioma-targeted siRNA delivery and release for therapeutic application. Small 2015;11:5142—50.
29.
Guo Q, Li C, Zhou WX, Chen XL, Zhang Y, Lu YF, et al. GLUT1-mediated effective anti-miRNA21 pompon for cancer therapy. Acta Pharm Sin B 2019;9:832—42.
30.
Zhao ZH, Zhang YJ, Li C, Li XW, Chu YC, Guo Q, et al. Microenvironment-tailored micelles restrain carcinoma-astrocyte crosstalk for brain metastasis. J Control Release 2022;349:520—32.
31.
Heinonen KM, Nestel FP, Newell EW, Charette G, Seemayer TA, Tremblay ML, et al. T-cell protein tyrosine phosphatase deletion results in progressive systemic inflammatory disease. Blood 2004;103:3457—64.
32.
Spalinger MR, Manzini R, Hering L, Riggs JB, Gottier C, Lang S, et al. PTPN2 regulates inflammasome activation and controls onset of intestinal inflammation and colon cancer. Cell Rep 2018;22:1835—48.
33.
Liang SW, Tran E, Du X, Dong JJ, Sudholz H, Chen H, et al. A small molecule inhibitor of PTP1B and PTPN2 enhances T cell antitumor immunity. Nat Commun 2023;14:4524.
34.
Liu JY, Geng XF, Hou JX, Wu GS. New insights into M1/M2 macrophages: key modulators in cancer progression. Cancer Cel Int 2021;21:389.
35.
Sun JL, Zhang NP, Xu RC, Zhang GC, Liu ZY, Abuduwaili W, et al. Tumor cell-imposed iron restriction drives immunosuppressive polarization of tumor-associated macrophages. J Transl Med 2021;19:347.
36.
Zhao W, Hao L, Jia LZ, Wang JS, Wang B, Huang YQ, et al. TAFs contributes the function of PTPN2 in colorectal carcinogenesis through activating JAK/STAT signaling pathway. Am J Cancer Res 2021;11:3085—97.
37.
Du W, Frankel TL, Green M, Zou WP. IFNgamma signaling integrity in colorectal cancer immunity and immunotherapy. Cell Mol Immunol 2022;19:23—32.
38.
Baumgartner CK, Ebrahimi-Nik H, Iracheta-Vellve A, Hamel KM, Olander KE, Davis TGR, et al. The PTPN2/PTPN1 inhibitor ABBV-CLS-484 unleashes potent anti-tumour immunity. Nature 2023;622:850—62.
39.
Choi KY, Han HS, Lee ES, Shin JM, Almquist BD, Lee DS, et al. Hyaluronic acid-based activatable nanomaterials for stimuli-responsive imaging and therapeutics: beyond CD44-mediated drug delivery. Adv Mater 2019;31:e1803549.
40.
He HS, Chen SZ, Fan ZC, Dong YP, Wang Y, Li SY, et al. Multi-dimensional single-cell characterization revealed suppressive immune microenvironment in AFP-positive hepatocellular carcinoma. Cell Discov 2023;9:60.
41.
Narunsky L, Oren R, Bochner F, Neeman M. Imaging aspects of the tumor stroma with therapeutic implications. Pharmacol Ther 2014;141:192—208.
42.
Hering L, Katkeviciute E, Schwarzfischer M, Busenhart P, Gottier C, Mrdjen D, et al. Protein tyrosine phosphatase non-receptor type 2 function in dendritic cells is crucial to maintain tissue tolerance. Front Immunol 2020;11:1856.
43.
Spalinger MR, Kasper S, Chassard C, Raselli T, Frey-Wagner I, Gottier C, et al. PTPN2 controls differentiation of CD4(+) T cells and limits intestinal inflammation and intestinal dysbiosis. Mucosal Immunol 2015;8:918—29.
44.
Wiede F, Shields BJ, Chew SH, Kyparissoudis K, van Vliet C, Galic S, et al. T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice. J Clin Investig 2011;121:4758—74.
Year 2025 volume 15 Issue 6
PDF
85
49
Cite this Article
BibTeX
Article Info
doi: 10.1016/j.apsb.2025.03.015
  • Receive Date:2024-09-28
  • Online Date:2026-04-03
Article Data
Affiliations
History
  • Received:2024-09-28
  • Revised:2024-12-03
  • Accepted:2025-01-10
Affiliations
    aKey Laboratory of Smart Drug Delivery Ministry of Education, Minhang Hospital, State Key Laboratory of Medical Neurobiology and MOE Frontiers Center for Brain Science, Institutes of Brain Science, Department of Pharmaceutics, School of Pharmacy, Fudan University, Shanghai 201203, China
    bDepartment of Gastroenterology and Hepatology and Shanghai Institute of Liver Diseases, Zhongshan Hospital, Fudan University, Shanghai 200032, China
    cPharmacy Department, Zhongshan Hospital, Fudan University, Shanghai 200032, China
    dPASTEUR, UMR8640, Department of Chemistry, PSL University, Sorbonne Université, CNRS, Ecole Normale Supérieure, Paris 75005, France

Corresponding:

* Corresponding authors.
References
Share
https://castjournals.cast.org.cn/joweb/apsb/EN/10.1016/j.apsb.2025.03.015
Share to
QR

Scan QR to access full text

Cite this article
BibTeX
Citations
表12种不同金属材料的力学参数

Family
属数
Number of
genus
种数
Number of
species
占总种数比例
Percentage of
total species (%)

Genus
种数
Number of
species
占总种数比例
Percentage of total
species (%)
鹅膏菌科Amanitaceae 2 11 5.26 鹅膏菌属 Amanita 10 4.78
小菇科 Mycenaceae 2 12 5.74 丝盖伞属 Inocybe 5 2.39
多孔菌科 Polyporaceae 8 14 6.70 蜡蘑属 Laccaria 5 2.39
红菇科 Russulaceae 3 23 11.00 小皮伞属 Marasmius 6 2.87
小菇属 Mycena 11 5.26
光柄菇属 Pluteus 5 2.39
红菇属 Russula 17 8.13
栓菌属 Trametes 5 2.39
关闭全屏
  • BibTeX
  • EndNote
  • RefWorks
  • TxT