收藏切换
Nose-to-brain delivery of targeted lipid nanoparticles as two-pronged β-amyloid nanoscavenger for Alzheimer's disease therapy
收藏切换
PDF
Yanyan Xua, b, Xiangtong Yeb, Yanfeng Dua, Wenqin Yangb, Fan Tongb, Wei Lia, Qianqian Huangb, Yongke Chenb, Hanmei Lic, Huile Gaob, *, Weiwei Zhanga, *
Acta Pharmaceutica Sinica B | 2025, 15(6) : 2884 - 2899
Less
收藏切换
Acta Pharmaceutica Sinica B | 2025, 15(6): 2884-2899
ORIGINAL ARTICLE
Nose-to-brain delivery of targeted lipid nanoparticles as two-pronged β-amyloid nanoscavenger for Alzheimer's disease therapy
Full
Yanyan Xua, b, Xiangtong Yeb, Yanfeng Dua, Wenqin Yangb, Fan Tongb, Wei Lia, Qianqian Huangb, Yongke Chenb, Hanmei Lic, Huile Gaob, *, Weiwei Zhanga, *
Affiliations
  • aSchool of Public Health, Chengdu Medical College, Chengdu 610500, China
  • bKey Laboratory of Drug-Targeting and Drug Delivery System of the Education Ministry and Sichuan Province, Sichuan Engineering Laboratory for Plant-Sourced Drug and Sichuan, Research Center for Drug Precision Industrial Technology, West China School of Pharmacy, Sichuan University, Chengdu 610041, China
  • cSchool of Food and Biological Engineering, Chengdu University, Chengdu 610106, China
doi: 10.1016/j.apsb.2025.02.035
Outline
收藏切换

Alzheimer's disease (AD), characterized by β-amyloid (Aβ) aggregation and neuroinflammation, remains a formidable clinical challenge. Herein, we present an innovative nose-to-brain delivery platform utilizing lactoferrin (Lf)-functionalized lipid nanoparticles (LNPs) co-encapsulating α-mangostin (α-M) and β-site APP cleaving enzyme 1 (BACE1) siRNA (siB). This dual-modal therapeutic system synergistically combines the neuroprotective and microglia-reprogramming capabilities of α-M with the transcriptional silencing of BACE1 via siB, thereby simultaneously inhibiting Aβ production and enhancing its clearance. Fabricated via a microfluidic approach, the LNPs exhibited uniform particle size distribution, great encapsulation efficiency, and robust colloidal stability. Upon intranasal administration, Lf-functionalization enabled superior brain-targeting efficacy through receptor-mediated transcytosis. In vitro studies demonstrated that α-M reversed Aβ-induced low-density lipoprotein receptor downregulation, promoting microglial phagocytosis and autophagic degradation of Aβ, while siB effectively suppressed BACE1 expression, abrogating Aβ synthesis. In vivo investigations in APP/PS1 transgenic mice revealed remarkable cognitive recovery, substantial Aβ plaque reduction, and alleviation of neuroinflammation and oxidative stress. This intricately designed LNP system, exploiting a non-invasive and efficient nose-to-brain delivery route, provides a biocompatible, synergistic, and transformative therapeutic strategy for the multifaceted management of AD.

Nose-to-brain delivery  /  Lipid nanoparticle  /  Alzheimer's disease  /  β-Amyloid clearance  /  α-Mangostin  /  β-Site APP cleaving enzyme 1  /  Targeted delivery  /  Synergistic therapy
Yanyan Xu, Xiangtong Ye, Yanfeng Du, Wenqin Yang, Fan Tong, Wei Li, Qianqian Huang, Yongke Chen, Hanmei Li, Huile Gao, Weiwei Zhang. Nose-to-brain delivery of targeted lipid nanoparticles as two-pronged β-amyloid nanoscavenger for Alzheimer's disease therapy[J]. Acta Pharmaceutica Sinica B, 2025 , 15 (6) : 2884 -2899 . DOI: 10.1016/j.apsb.2025.02.035
Fueled by the extended life expectancy, AD has emerged as a major public health concern with a sharp rise in its global prevalence, contributing to significant medical and financial burdens1-3. Constrained by modest symptomatic relief and a narrow target population, current clinical AD treatments are of limited benefit4,5. In AD pathogenesis, accumulated Aβ plaque is a leading hallmark, which induces inflammation and triggers neuronal toxicity6-8. Recent approvals of Aducanumab and Lecanemab manifested the feasibility of Aβ-associated macromolecular therapeutics, on account of superior target precision, disease-modifying potential, and less off-target effect6,9-11. However, both the unsatisfactory clinical outcomes and non-negligible adverse events underscored the imperative demands for more effective and safer AD remedies9,12,13.
Compared to the aforementioned monoclonal antibodies, nucleic acid-based genetic drugs, such as siRNA, can directly reprogram the central dogma of biology to prevent and treat diseases14. For instance, the first approved siRNA drug, Onpattro (patisiran), targets and degrades the messenger RNA of transthyretin, mitigating the production of misfolded proteins in hereditary transthyretin-mediated amyloidosis15,16. Similarly, β-site APP cleaving enzyme 1 (BACE1) plays a crucial role in the formation of Aβ plaques, which can be silenced via BACE1 siRNA (siB), thus obstructing the onset of subsequent cascades such as neuroinflammation and neurodegeneration in the early phase of AD17-20. In addition, for AD patients suffering from the advanced stage, it is also indispensable to clear existing Aβ plaques and modulate the inflammatory brain microenvironment21,22. α-Mangostin (α-M) is a natural polyphenolic compound, exhibiting a potent antioxidant activity to alleviate oxidative stress and shield neurons from further damage. Besides the anti-inflammatory effect, α-M also possesses the capability to upregulate low-density lipoprotein receptor (LDLR) expression in microglia to facilitate Aβ uptake and reprogram metabolism in the disease-associated microglial to holistically rejuvenate Aβ clearance capacity23,24. Therefore, the combination of siB and α-M is anticipated to be a thorough AD regimen that encompasses the full spectrum of AD stages. Nevertheless, siRNA is a negatively charged macromolecule, and α-M is lipophilic, both of which are highly susceptible to degradation when exposed to the bloodstream. Therefore, the urge for optimized drug delivery platforms is elemental, thus realizing better stability, greater biodistribution to the desired site of action, and implementing the full potential of this combination therapy.
Following the prominent success garnered by COVID-19 mRNA vaccines, ionizable cationic LNP has emerged in the limelight for nucleic acid therapeutic delivery25,26. LNP is the most clinically state-of-the-art non-viral gene delivery platform, featuring outstanding delivering potency, biocompatibility, and the capability for repeated administration, which favors clinical translation27,28. At the same time, due to the lipid vesicle structure, LNP is also eligible for encapsulating liposoluble small-molecular therapeutics such as α-M, thereby becoming an optimal selection to load and deliver siB and α-M simultaneously. However, upon intravenous injection, the adsorption of proteins in the blood and the formation of protein corona leads to the liver tropism of LNP29-32. Consequently, intranasal administration surpasses conventional intravenous routes by offering a non-invasive, efficient, and direct pathway to the brain, circumventing the BBB and ensuring enhanced patient compliance19,33-36. Drugs administered intranasally can traverse the trigeminal and olfactory nerve pathways, utilizing axonal transport to further extend to the olfactory bulb and brain stem, guaranteeing high bioavailability, expeditious onset of action, improved patient compliance, and reduced systemic toxicity34,37-39. To prolong residence time and carry out higher brain entry efficiency, it is of great necessity to tailor specific targeting moiety on the surface of LNP, which is viable due to the manifold functional groups offered by lipids28,40-42. Given that the lactoferrin (Lf) receptor is upregulated in both respiratory epithelial cells and neurons for AD patients, Lf is exploited to embellish LNP to accomplish dual targeting43-46. Overall, engineering an LNP modified by Lf to simultaneously deliver α-M and siB (α-M/siB@L-Lf) via a nose-to-brain route represents a groundbreaking paradigm of AD therapy. More significantly, supplementing with mucolytic agents such as N-acetyl cysteine (NAC) was critical for improving the permeation by dissolving mucus and enhancing the targeting efficiency of nose-to-brain delivery37,41.
Herein, the nose-to-brain targeted α-M/siB@L-Lf was contrived and co-administered with NAC (α-M/siB@L-Lf + N) to scavenge Aβ in a two-pronged manner for AD treatment (Scheme 1). Following intranasal administration, Lf-conjugated LNPs were delivered to the brain and then neurons via clathrin-mediated endocytosis44-47. Upon release from the nanoparticles, α-M and siB synergistically target Aβ pathology through distinct yet complementary mechanisms, curtailing its generation while facilitating its elimination. In vivo and in vitro data validated the synergistic potency of α-M/siB@L-Lf, triumphantly achieving the remodeling of abnormal lesion microenvironment and the rescue of cognitive loss. Collectively, this nanosystem represented a significant advancement, merging an innovative delivery route with a synergistic therapeutics strategy to address the multifaceted pathology of AD.
SM-102, DSPC, and DMG-PEG2000 were obtained from AVT Pharmaceutical Tech Co., Ltd. (Shanghai, China). Cholesterol and NAC was purchased from Macklin Biochemical Technology Co., Ltd. (Shanghai, China). DSPE-PEG2000-Mal was purchased from Yusi Medical Technology Cable Co., Ltd. (Chongqing, China). 2-Iminothiolane hydrochloride, lactoferrin (from bovine milk), and α-mangostin were all available from Aladdin Biochemical Technology Co., Ltd. (Shanghai, China). The BACE1 siRNA (sense: GCUUUGUGGAGAUGGUGGATT, antisense: UCCACCAUC UCCACAAAGCTT), negative control siRNA (sense: UUCUCCGAACGUGUCACGUTT, antisense: ACGUGACA CGUUCGGAGAATT), and Cy5-negative control siRNA were purchased from Genemed Biotechnology Co., Ltd. (Chengdu, China). Amyloid-β (1–42) peptide (Aβ1–42) and FITC-amyloid-β (1–42) peptide (FITC-Aβ1–42) were purchased from GL Biochem Ltd. (Shanghai, China). Complete Dulbecco's modified Eagle's medium (DMEM), trypsin-EDTA solutions, and fetal bovine serum (FBS) were purchased from Gibco (USA). The anti-BACE1, anti-LDLR, anti-APP, anti-GAPDH, anti-β-tubulin, anti-β-actin antibodies, and horseradish peroxidase-conjugated goat anti-rabbit and goat anti-mouse IgG (H + L) secondary antibodies were purchased from ABclonal Technology Co., Ltd. (Wuhan, China). The anti-LC3B antibody was obtained from Cell Signaling Technology, Inc. (USA). ELISA kits (BACE1 and Aβ1–42) were purchased from Ruixin Biotechnology Co., Ltd. (Quanzhou, China). Enzyme-linked immunosorbent assay (ELISA) kits (IL-1β and IL-6) were purchased from BD Pharmingen (USA). All chemicals utilized were of analytical or reagent-grade quality.
The BV-2, PC-12, and Calu-3 cell lines were obtained from the Chinese Academy of Sciences Cell Bank (Shanghai, China). Male C57BL/6 mice were provided by SPF Biotechnology Co., Ltd. (Beijing, China). Male APP/PS1 mice were purchased from Changzhou Cavens Experimental Animal Co., Ltd. All animals were raised under standard housing conditions. All animal experiments were performed in accordance with the guidelines laid down and approved by the experimental animal management committee of Sichuan University. The assigned approval/accreditation number was KS2020420.
A microfluidic-chip device from Nexstar Nano Technology Co., Ltd. (Shanghai, China) was employed to fabricate the LNPs with uniform particle size. The lipid ethanol phase contained a mixture of SM-102, DSPC, cholesterol, DMG-PEG2000, and DSPE-PEG2000-Mal at molar ratios of 42:13:43:1.5:0.5. siR was dissolved in 20 mmol/L sodium acetate (NaOAc) buffer (pH 4.0) to compose the siRNA aqueous phase. The two phases were connected separately to the corresponding syringes, and the volume ratio of the organic phase to the aqueous phase was 1:3. The resulting LNPs were obtained through rapid mixing of the two channels of the chip at a total flow rate of 12 mL/min. The LNPs were then ultrafiltered (MW = 10 kDa) three times to remove the ethanol and replace the buffer with 1 × phosphate-buffered saline (PBS) (pH 7.2).
For Lf decoration, Lf was first thiolated in reaction with a 5:1 M excess of 2-iminothiolane hydrochloride in 0.15 mol/L sodium borate buffer (pH 8.0 supplemented with 0.1 mmol/L EDTA) under nitrogen at room temperature for 1 h. Then, the thiolated Lf was ultrafiltered (MW = 30 kDa) three times with 1 × PBS (pH 7.2) to remove excess 2-iminothiolane hydrochloride. The LNPs were mixed with previously prepared thiolated Lf and continuously reacted under nitrogen at room temperature for 12 h. The Lf-decorated LNPs were ultrafiltered (MW = 100 kDa) three times with 1 × PBS (pH 7.2) to remove excess unreacted Lf.
Agarose was dissolved in tris acetate/EDTA (TAE) buffer and mixed with GelRed to form 2% agarose gel. Negative control siRNA (NC) was encapsulated in LNP (NC@L) at 1:1, 2:1, 4:1, 8:1, 12:1, and 16:1 N/P ratios, respectively. The samples were diluted in the loading buffer. The mixtures were separated via electrophoresis for 20 min at 100 V. The gel was detected and photographed using the UV illuminator.
PC-12 cells were seeded in 12-well plates at a density of 4 × 104 cells per well. After achieving appropriate confluency, the culture medium was removed and cells were washed with PBS (pH 7.2) twice. Cy5-labeled NC encapsulated by LNPs (Cy5-NC@L) and Lf-decorated LNPs (Cy5-NC@L-Lf) were diluted in FBS-free medium at the same concentration of Cy5-NC were added to the plates respectively and incubated for 0.5, 2, and 4 h, respectively. Subsequently, the cells were washed three times with PBS (pH 7.2), digested and dispersed in 0.4 mL PBS for flow cytometry (FCM, Agilent NovoCyte, Palo Alto, USA). For fluorescence imaging observation, PC-12 cells were planted into 12-well plates covered with a round coverslip, and the administration protocol was consistent with the flow cytometry analysis. After incubation, the coverslips were washed three times with PBS, fixed with 4% paraformaldehyde, stained with DAPI solution (2 μg/mL) for 5 min, washed again, immersed in Antifade Mounting Medium (Solarbio Life Science, Beijing), and ultimately sealed for confocal laser scanning microscope (CLSM) (Leica, DMi8, Weztlar, Germany) observation. Calu-3 cells were processed with the same protocol.
Lyophilized human Aβ1–42 monomer peptide, purified by HPLC (>95%), was used to generate Aβ1‒42 oligomers following a previously described protocol48. The Aβ1–42 monomer was first dissolved in anhydrous DMSO to a concentration of 2 mmol/L, then diluted in ice-cold Opti-MEM to achieve a final concentration of 100 μmol/L. After vortexing for 30 s, the resulting solution was incubated at 4 ℃ for 24 h prior to use.
BV-2 cells were seeded in 12-well plates at a density of 5 × 104 cells per well. After achieving appropriate confluency, the cells were treated with α-M/NC@L-Lf at different α-M concentrations for 24 h. At the last 3 or 1 h of the treatment, the culture medium was replaced with fresh medium containing 2 μmol/L FITC-Aβ1–42. After incubation, the cells were washed three times with cold PBS (pH 7.2), digested, and collected to quantify the fluorescence of FITC via flow cytometry (Agilent). For qualitative analysis of cellular phagocytosis, cover slides with BV-2 cells were prepared. The treatment scheme was the same as the quantitative analysis. After incubation, the slices were processed with the same method as the cellular uptake protocol for CLSM (Leica) observation.
For the mechanism exploration, BV-2 cells were seeded in 6-well plates at a density of 2 × 105 cells per well. After achieving appropriate confluency, the cells were treated with α-M/NC@L-Lf at different α-M concentrations and 8 μmol/L Aβ1–42 oligomers for 24 h. Then, the cells were washed three times with cold PBS (pH 7.2) and lysed using RIPA lysis buffer (Beyotime Biotechnology, Shanghai) to obtain the total protein. The protein was mixed with 5 × SDS-PAGE sample loading buffer (Beyotime Biotechnology, Shanghai), boiled for 10 min for full denaturation, and subjected to western blotting analysis for the detection of LDLR expression.
BV-2 cells were seeded in 6-well plates at a density of 2 × 105 cells per well. After achieving appropriate confluency, the cells were treated with different preparations and 8 μmol/L Aβ1–42 oligomers for 24 h. The final concentration of α-M was 400 ng/mL. Then, the cells were harvested and processed with the method of western blotting mentioned above, thus obtaining the expression level of autophagosome marker LC3B.
The upregulation of LDLR expression and endogenous BACE1 gene silencing ability of LNPs were investigated by quantitative real-time PCR (qRT-PCR).
LDLR: BV-2 cells were seeded in a 12-well plate at a density of 5 × 104 cells per well. After achieving appropriate confluency, the cells were treated with different preparations and 8 μmol/L Aβ1–42 oligomers for 24 h. The final concentration of α-M was 400 ng/mL. The total RNA was extracted using the Cell Total RNA Isolation Kit (Foregene, China), and then reverse transcribed into cDNA using a Hifair® Ⅲ 1st Strand cDNA Synthesis SuperMix (Yeasen, China). Later, qRT-PCR was performed according to BrightCycle Universal SYBR Green qPCR Mix with UDG (ABclonal, China).
BACE1: PC-12 cells were seeded in a 12-well plate at a density of 5 × 104 cells per well. After achieving appropriate confluency, the cells were treated with different preparations and 8 μmol/L Aβ1–42 oligomers for 24 h. The final concentration of siB was 400 nmol/L. The following qRT-PCR procedures were outlined above.
The primer and reverse primer sequences are as follows: BACE1: F, GGAACCCATCTCGGCATCC; R, TCCGATTCCTCGTCGGTCTC; LDLR: F, GAAGGCAGCTACAAGTGTGAG; R, GGGGAGCAGACTGGTGTACT; and β-actin: F, GGCTGTATTCCCCTCCATCG; R, CCAGTTGGTAACAATGCCATGT.
PC-12 cells were seeded in 96-well plates at a density of 4 × 103 cells per well and incubated for 12 h. Then, the medium was removed and the cells were treated with fresh medium containing 20 μmol/L Aβ1–42 oligomers and various treatments (α-M 400 ng/mL, siB 400 nmol/L). After 36 h co-culture, the medium was replaced with DMEM medium, and the cell viability was assessed via MTT assay.
Calu-3 cells were seeded in the insert of the Transwell plate (12 wells, pore size: 0.4 μm, Corning, USA) at a density of 3 × 104 cells per well to obtain a nasal epithelial cell model. The culture medium was changed daily, and the transepithelial electrical resistance (TEER) value was detected regularly (Millicell-ERS, Millipore, USA) and calculated as Eq. (1):
where Rsample was the resistance in cell-seeded wells, Rblank was the resistance in blank wells without cells, and A was the surface area of the membrane in the insert.
When the TEER value reached about 500 Ω·cm2, the culture condition was converted to an air-liquid interface (ALI), allowing the differentiation of Calu-3 cells to obtain a tight epithelial barrier and mucus secretion49. During the ALI, the TEER value was measured after adding the culture medium to the insert and equilibrating in the culture incubator for 30 min. When the measurement was finished, the culture medium was removed to maintain ALI. The formal experiment was allowed to be conducted when the TEER values were stable. Cy5-NC@L, Cy5-NC@L-Lf, and Cy5-NC@L-Lf with NAC (Cy5-NC@L-Lf + N), all at the same concentration of Cy5-NC, were added to the insert in a volume of 0.5 mL, with 1 mL of fresh medium in the lower chamber. At the predetermined time points of 2, 6, and 12 h, 0.2 mL of the medium in the lower chamber was collected and the same amount of fresh medium was supplemented. The standard curve for the apparent fluorescence intensity of the LNPs in vitro was constructed, meanwhile, the apparent permeability coefficient (Papp) was quantified, which was calculated as Eq. (2):
dQ/dt was the rate of change of the amount of Cy5-NC (Q) over time (t), C0 was the initial concentration of Cy5-NC, and A was the surface area of the membrane in the insert.
Additionally, the upper chamber monolayer membranes were harvested at different time points and observed via CLSM (Leica).
C57BL/6 mice were randomly divided into three groups (5 mice per group) and intranasally administered with 20 μL of Cy5-NC@L, Cy5-NC@L-Lf, and Cy5-NC@L-Lf + N, each at the same concentration of Cy5-NC. Mice were executed at 0.25 and 1 h post administration to separate their brains and main organs. The Lumina III Imaging System (PerkinElmer, Waltham, USA) was employed for ex vivo fluorescence imaging. Then, the brain tissue was fixed in 4% paraformaldehyde solution for 24 h, dehydrated with 15% and 30% sucrose solution for 48 h, and sectioned at 10 μm by freezing microtome (Leica CM1950, Germany). Ultimately, brain tissue frozen sections were stained with DAPI (2 μg/mL) and observed via CLSM (Leica).
10-Month-old APP/PS1 mice were randomly divided into 5 groups (6 mice per group). C57BL/6 mice were used as control (WT). α-M and siB loaded-LNP (α-M/siB@L), Lf-modified siB loaded-LNP (siB@L-Lf), α-M/siB@L-Lf, and α-M/siB@L-Lf + N were administered intranasally (0.5 mg/kg α-M, 0.5 mg/kg siB, every 2 days for 7 times) to different groups, while PBS (pH 7.2) were given the same way to APP/PS1 mice in AD group as control. Body weight was recorded every 2 days. During the administration, gas anesthesia was administered concurrently. After completion of treatment, behavioral tests were performed.
Morris water maze (MWM), Y-maze, and nest-building test were adopted to comprehensively evaluate the cognitive function and behavioral status of mice. The experimental protocols followed the approach described in previous studies50,51. In addition, the criteria for nest scoring were modified slightly: (0) the paper was not torn, and had no obvious nest site; (1) the paper was torn slightly with no obvious nest site; (2) the paper was torn partially, but the nest site was identifiable; (3) partially torn paper with identifiable nest site; and (4) most of the paper towels were bitten with identifiable nest site.
After the behavioral tests, blood samples were collected from the mice, then all of the mice were sacrificed to obtain brain tissue. Whole blood and serum samples were sent for complete blood count and blood biochemical analysis, respectively. At the same time, some brains, nasal cavities, and main organs were harvested for hematoxylin and eosin (H&E) or Nissl staining to evaluate the cumulative toxicity and neuroprotective effects of the LNPs. Immunohistochemical staining of Aβ, as well as immunofluorescence staining of ROS, GFAP, IBA-1, and NeuN, were performed on brain slices of different groups. Brain RNA and proteins were extracted for qPCR, western blotting, and ELISA.
All data were presented as mean ± standard deviation (SD). Statistical analysis was carried out using GraphPad Prism software (version 7.04). One-way analysis of variance (ANOVA) with Tukey's test and two-way ANOVA with Sidak's test were used for the statistical comparison between groups with one independent variable and two independent variable variables, respectively. A significant difference was considered when the P value was less than 0.05, and ns represented not significant. Dots overlaid on the bar graphs are the values measured for biological replicates.
Microfluidic-chip device is an extensively exploited LNP fabrication approach to obtain uniform nanoparticles, with high controllability and reproducibility. SM-102, DSPC, cholesterol, DMG-PEG2000, and DSPE-PEG2000-Mal were dissolved in ethanol according to the formulation (Fig. 1A), which was the lipid organic phase. For α-M-loaded LNP, α-M was also dissolved in ethanol at 1 mg/mL. In addition, the siRNA aqueous phase was prepared by adding the siB into the NaOAc buffer. The two phases were mixed thoroughly to obtain homogeneous LNPs (Fig. 1B). During the mixing, the ionizable headgroup of SM-102 turned to be positively charged and electrostatically bound negatively charged siRNAs in an acidic buffer, allowing stable siRNA encapsulation inside the LNPs and offering protection against enzymatic degradation. Agarose gel electrophoresis indicated that a complete encapsulation of siRNA was achieved when the N/P ratio reached 8 (Fig. 1C). The capsulation efficiency of siRNA was 91.85% via RiboGreen assay (Supporting Information Fig. S1). The weight ratio of SM-102 to siRNA was 17.22, which was applied for follow-up experiments. For Lf decoration, the modification ratio of Lf was about 56.17% according to the BCA assay (Supporting Information Fig. S2). Then, the encapsulation efficiency and loading capacity of α-M in α-M/siB@L-Lf were determined to be 35.64% and 8.91%, respectively, demonstrating the successful incorporation (Supporting Information Fig. S3). The hydrodynamic diameter determined via dynamic light scattering (DLS) of α-M/siB@L and α-M/siB@L-Lf was 84.97 ± 1.44 nm and 107.89 ± 1.34 nm, respectively (Fig. 1D). The surface charge of α-M/siB@L-Lf was −10.62 ± 5.48 mV. The transmission electron microscope (TEM) image revealed the uniform spherical shape of α-M/siB@L-Lf, and the diameter was consistent with the DLS results (39.97 ± 3.57 nm) (Fig. 1E). Moreover, differed from plain spherical morphology, the spheres of the α-M/siB@L-Lf were slightly antenna-like, which might be attributed to the successful conjugation of Lf. The LNPs, especially the Lf-decorated ones, demonstrated excellent storage stability, with no significant changes in particle size observed over 48 h (Fig. 1F and G).
According to the thiazolyl blue (MTT) assay, BV-2 cells were more sensitive to the ascending concentration of α-M, which exhibited mild death when the concentration of α-M reached 800 ng/mL (Fig. 2A), while PC-12 showed better tolerance (Fig. 2B). At the same time, the stronger cytotoxicity engendered by Lf-decorated LNPs could be attributed to the higher cellular uptake mediated by Lf. Calu-3 cells are generally utilized to simulate olfactory epithelium transport in vitro, which were adopted along with PC-12 cells to verify the reinforced receptor-mediated endocytosis endowed by Lf43,44,46. The flow cytometry analysis displayed that, the cellular uptake of Cy5-NC@L-Lf was 9.36- and 4.71-fold higher than Cy5-NC@L for PC-12 cells and Calu-3 cells at 4 h, respectively (Fig. 2C, Supporting Information Fig. S4). The internalization of Cy5-NC@L and Cy5-NC@L-Lf by these cell lines was also observed qualitatively via CLSM (Fig. 2D, Supporting Information Fig. S5). The fluorescence of Cy5-NC@L-Lf was more robust than that of Cy5-NC@L at each time point. The results above collectively served as evidence that a conspicuous cellular uptake enhancement was brought in by Lf.
As intracerebral Aβ scavengers, BV-2 cells eliminate Aβ plaques and convert the brain environment from pathological and inflammatory to healthy. Upon the modulation of α-M/NC@L-Lf at different α-M concentrations for 24 h, a significantly augmented uptake of FITC-Aβ was observed via both the flow cytometer and the CLSM (Fig. 2E, Supporting Information Fig. S6). Compared to the control group, α-M/NC@L-Lf-treated ones exhibited an enhanced Aβ internalization at 100, 200 and 400 ng/mL of α-M after 3 h, all of which were over 1.70-fold. The LDLR downregulation induced by Aβ oligomers was restored in the presence of α-M/NC@L-Lf, according to the result of western blotting analysis (Fig. 3A and B). The result was further verified in LDLR mRNA level via qRT-PCR analysis under the treatment of α-M/NC@L and α-M/NC@L-Lf, and the upregulation efficiency compared to Aβ oligomers-treated groups was 81.19% and 237.55%, respectively (Fig. 3C). These findings collaboratively unveiled that, α-M-loaded LNPs could effectively upregulate the LDLR expression on BV-2 cells, thereby rejuvenating the phagocytosis of Aβ. At the same time, due to the reprogramming of BV-2 cells triggered by α-M, the autophagy activity of α-M/siB@L-Lf-treated groups was elevated by 17.40% compared to Aβ oligomers-treated ones, thus contributing to the promoted degradation of phagocytosed Aβ (Fig. 3D and E). The finding underscored the efficacy of α-M-loaded LNPs in promoting Aβ elimination via enhanced LDLR expression, Aβ phagocytosis, and autophagic degradation, thereby assisting the homeostasis restoration in the brain environment.
In addition, siB encapsulated in LNPs showed a significant BACE1 downregulation efficiency. According to western blotting analysis, the silencing efficiency of siB-loaded LNP (siB@L) and siB@L-Lf was 83.44% and 66.38%, while the LNP itself without siB was noneffective (Fig. 3F and G). Moreover, the Aβ-induced BACE1 mRNA increase was also retarded with the treatment of siB@L and siB@L-Lf (Supporting Information Fig. S7). These experiments validated the potential of siB-loaded LNPs in the BACE1 expression knockdown, thus ceasing the Aβ production with α-M in a two-pronged manner.
Ultimately, the neuroprotection of α-M/siB@L-Lf against injury induced by Aβ oligomers was investigated via the MTT analysis (Fig. 3H). The survival rate of PC-12 cells decreased to 53.11% after the co-incubation with Aβ oligomers for 36 h. The cell damage was moderately alleviated by the addition of α-M for its polyphenol structure-derived anti-inflammatory effect. Meanwhile, siB@L-Lf also exhibited similar cell viability restoration ability (70.69%), which might be attributed to the siB that deferred the Aβ oligomers-induced pathological deterioration for PC-12 cells themselves. For α-M/siB@L-Lf-treated groups, the cell death ceased utterly, indicating a significant neuroprotective effect (95.59%) introduced by both the α-M and siB.
To verify the nose-to-brain transmembrane efficiency endowed by Lf conjugation and the addition of permeation enhancer NAC, a nasal epithelial cell model was established (Fig. 4A). Initiated by removing the apical medium and changing the culture condition from submerged to ALI, the differentiation of Calu-3 cells allowed the formation of a functional tight epithelium, thus obtaining an in vitro nasal model with tight epithelial barrier and mucus secretion. The TEER values were monitored regularly (Fig. 4B), and the formal experiment was conducted when the TEER value reached a stable level at about 350 Ω·cm2 after ALI. The medium in the lower chamber and the upper cell membrane were collected after co-incubation for 2, 6, and 12 h, respectively. The Papp of Cy5-NC@L-Lf + N groups was 1.66 × 10−6 cm/s at 2 h, manifesting the highest transport rate among the three groups (Fig. 4C). At 6 h, the Papp of Cy5-NC@L-Lf + N groups was 1.69- and 1.22-fold compared to Cy5-NC@L and Cy5-NC@L-Lf groups. Similarly, the transcytosis and the penetration through the apical monolayer cell membrane were captured via CLSM (Fig. 4D and E), indicating an enhanced uptake and transportation during the time course.
To further validate the potential of LNPs to enter the brain through the nose-to-brain route, the transportation was monitored at 0.25 and 1 h after intranasal administration in C57BL/6 mice via near-infrared fluorescence imaging. The Cy5 fluorescence intensity of Cy5-NC@L-Lf + N in the brain at 0.25 and 1 h was both detected as the highest among all groups, demonstrating its prominent brain entry efficiency benefited from both the Lf and NAC (Fig. 4F). The semi-quantification of brain fluorescence showed that the brain accumulation of Cy5-NC@L-Lf + N was 1.68- and 1.78-fold stronger than that of Cy5-NC@L-Lf and Cy5-NC@L at 1 h, showcasing the considerable augmentation of brain targeting and accumulation (Fig. 4G). However, in comparison to the in vitro experiment outcomes, a negligible difference was observed in brain-targeting efficiency in vivo between Cy5-NC@L-Lf and Cy5-NC@L groups, which might have resulted from the inhibitory effects of nasal mucus and ciliary motion in the nasal cavity, thus emphasizing the indispensability of NAC. Furthermore, the preferential accumulation of Cy5-NC@L-Lf + N in the brain highlighted its superior brain-targeting capability and demonstrated the potential of nose-to-brain LNP delivery (Fig. 4H). Whereafter, the brain tissue at 1 h after administration was frozen-sliced to further confirm the accumulation of LNPs via CLSM (Supporting Information Fig. S8). Likewise, the fluorescence intensity of Cy5-NC@L-Lf + N was stronger than that of the other two groups, which was concordant with previous results of the ex vivo imaging. The above experiments collaboratively disclosed the prospect that the Lf modification and the addition of NAC are conducive to transport efficiency via the nose-to-brain route, which prominently tackled the traditional brain targeting hurdle and refreshed AD therapy.
A series of different LNP preparations were applied every two days to 10-month-old APP/PS1 transgenic mice to assess the therapeutic effects on AD (Fig. 5A). APP/PS1 mice were grouped randomly and received intranasal administration with different LNPs and PBS (as a control). WT mice were employed to confirm the AD-relevant deficits in transgenic mice at baseline. On accomplishing the last administration, various behavioral experiments were performed to comprehensively evaluate the cognitive function and behavioral state of mice. During the MWM training, the escape latency of α-M/siB@L-Lf + N group was significantly shortened, exhibiting a great spatial memory and reaching a level similar to that of WT group, while PBS-treated APP/PS1 mice remained unintentional swimming (Fig. 5B). In the test, the mice exhibited similar swimming speed (Fig. 5C), and the swimming trajectories for searching the platform were similar to the results of the training (Fig. 5D, Supporting Information Fig. S9). The mice in the α-M/siB@L-Lf + N group manifested an evident preference for the platform area not only in the time of seeking (Fig. 5E) but also in the crossing frequency (Fig. 5F), which demonstrated the effectiveness of α-M/siB@L-Lf + N treatment in rescuing spatial learning and memory deficits. α-M/siB@L-Lf group also showed moderate improvement, whereas the therapeutic outcome might be constrained by the obstacle in the intranasal mucus penetration. Similarly, the Y-maze test was conducted to analyze the exploratory behavior and short-term memory in a novel environment via the activity heatmap and the alternation (Fig. 6A and B). Compared with PBS-treated APP/PS1 mice, all the LNP preparation-treated mice were more active, and the spontaneous alternations of which were remarkably higher and close to the level of WT mice. In the nest building test (Fig. 6C and D), α-M/siB@L-Lf + N-treated mice attained a similar score to the WT mice, further confirming the restoration of impaired innate behavioral execution as well as cognitive dysfunction in APP/PS1 mice. The above results congruously illustrated that α-M/siB@L-Lf administered along with NAC could attenuate cognitive and learning deficits in APP/PS1 mice, while other LNP-treated groups yielded less satisfactory therapeutic effect due to onefold treatment or lower delivery efficiency, thereby revealing the indispensability of combination therapy for AD and the addition of NAC for nose-to-brain delivery.
Aβ deposition and activation of glial cells are leading perpetrators of prolonged neuroinflammation, contributing to overwhelming oxidative stress and prominent neuronal apoptosis. First, the Aβ levels in the brain were determined via immunohistochemical staining (Fig. 7A) and ELISA (Fig. 7B). Compared with PBS-treated APP/PS1 mice, the Aβ levels of α-M/siB@L-Lf and α-M/siB@L-Lf + N-treated mice were significantly dwindled. Next, the mechanisms of the Aβ scavenging were explored. ELISA, qRT-PCR, and western blotting analysis showed a general decline of BACE1 expression almost in all LNPs-treated groups (Fig. 7C–F). However, although BACE1 levels were downregulated in α-M/siB@L and siB@L-Lf groups, no thorough improvement was observed in these two groups during previous behavioral experiments, indicating the inadequacy of siRNA monotherapy and the importance of combining α-M and BACE1 siRNA for two-pronged Aβ elimination therapy. Therefore, in addition to BACE1 inhibition to impede Aβ generation, the α-M-triggered upregulation of LDLR for enhanced Aβ uptake in the α-M/siB@L-Lf + N-treated group was a significant contributor to scavenge existing Aβ plaques, as verified via qRT-PCR analysis (Fig. 7G). Additionally, benefiting from the improved brain environment, the expression of APP, a biomarker representing the pathological progression and severity of AD, was downregulated (Fig. 7H and I). Then, IBA-1 and GFAP were employed to label activated microglia and astrocytes, which were detrimental to the restoration of brain52-54 (Fig. 8A). The aberrant proliferation and exorbitant activation of these glial cells were devastating the brains of APP/PS1 mice, whereas the α-M/siB@L-Lf and α-M/siB@L-Lf + N treatments were capable of appeasing the excess activation and boosting the normalization of the brain microenvironment.
The alleviation of Aβ burden as well as the reduced activation of glial cells could efficiently lessen the ROS damage and refine the brain environment. With DHE probe staining indicating the ROS level (Fig. 8B), a powerful ROS scavenging could be spotted in the α-M/siB@L-Lf + N-treated group, which was achieved via both the combination therapy and the effective drug delivery. To quantify the level of inflammatory-related cytokines, qRT-PCR analysis and ELISA were performed. IL-1β and IL-6 are crucial pro-inflammatory cytokines, which were diminished after the treatment of α-M/siB@L-Lf and α-M/siB@L-Lf + N (Fig. 9A–C). The elevated levels of superoxide dismutase (SOD) (Fig. 9D) in serum further demonstrated a significant reduction in oxidative stress. Additionally, neuronal marker NeuN was applied to detect the neuron (Fig. 9E). An apparent apoptosis could be observed in the brain of APP/PS1 mice, while the α-M/siB@L-Lf + N treatment rescued the neuron damage and revitalized the neuron density. Then, the results obtained via H&E staining (Fig. 9F) and Nissl staining (Supporting Information Fig. S10) reached a similar conclusion, that the distinct nuclear shrinkage and damages were ameliorated, which supported the rehabilitation of memory and learning ability.
Eventually, the systemic toxicity of these LNP formulations was evaluated. First, during the process of intranasal administration, the body weight among the groups was stable (Supporting Information Fig. S11). Also, no noticeable pathological abnormalities were observed in major organs with H&E staining (Supporting Information Fig. S12), complete blood count analysis, and blood biochemical examinations (Supporting Information Figs. S13 and S14). Moreover, the nasal cavities of each group were observed via H&E staining (Supporting Information Fig. S15), with intact structures, bushy cilia, and no pathological changes. Taken together, these results showed the good in vivo biocompatibility of these LNPs.
In this study, we engineered a sophisticated multifunctional lipid nanoparticle system (α-M/siB@L-Lf) tailored for direct nose-to-brain delivery, offering a comprehensive strategy to combat the multifactorial pathology of AD. First, Lf functionalization of LNP facilitated receptor-mediated transcytosis across the nasal epithelial barrier, enabling direct brain targeting while minimizing systemic circulation exposure. To further improve nasal epithelial penetration and prolong residence time, NAC was incorporated as a mucolytic agent, facilitating efficient traversal of the nasal epithelial barrier and amplifying brain bioavailability.
This nanosystem leveraged the synergistic therapeutic potential of α-M and siB—enhancing Aβ clearance through microglial reprogramming and autophagic activation, while simultaneously suppressing Aβ production via precise BACE1 silencing. In vitro investigations demonstrated that α-M effectively restored Aβ-induced LDLR suppression, potentiating microglial phagocytosis and autophagic degradation of Aβ, while siB achieved potent BACE1 knockdown to mitigate Aβ synthesis. In vivo studies in APP/PS1 transgenic mice exhibited profound cognitive restoration, significant attenuation of Aβ plaque burden, and substantial alleviation of neuroinflammation and oxidative stress. Of note, the synergistic integration of NAC with Lf-modified LNPs markedly enhanced delivery efficiency, resulting in superior therapeutic outcomes.
In summary, this meticulously designed system exemplified a transformative, non-invasive, and biocompatible therapeutic paradigm for AD. By harnessing the combined strengths of targeted LNPs, mucolytic enhancement via NAC, and a multi-modal therapeutic mechanism, this platform effectively addressed both upstream and downstream pathological hallmarks of the disease. These findings not only underscored its remarkable therapeutic potential but also established a robust foundation for the clinical translation of nose-to-brain delivery systems in the treatment of neurodegenerative disorders.
1.
Nichols E, Steinmetz JD, Vollset SE, Fukutaki K, Chalek J, Abd-Allah F, et al. Estimation of the global prevalence of dementia in 2019 and forecasted prevalence in 2050: an analysis for the Global Burden of Disease Study 2019. Lancet Public Health 2022;7:e105—25.
2.
Scheltens P, De Strooper B, Kivipelto M, Holstege H, Chételat G, Teunissen CE, et al. Alzheimer’s disease. Lancet 2021;397:1577—90.
3.
2022 Alzheimer’s disease facts and figures. Alzheimers Dement 2022;18:700—89.
4.
Long JM, Holtzman DM. Alzheimer disease: an update on pathobiology and treatment strategies. Cell 2019;179:312—39.
5.
Cummings J, Aisen PS, DuBois B, Frölich L, Jack Jr CR, Jones RW, et al. Drug development in Alzheimer’s disease: the path to 2025. Alzheimers Res Ther 2016;8:39.
6.
Karran E, De Strooper B. The amyloid hypothesis in Alzheimer’s disease: new insights from new therapeutics. Nat Rev Drug Discov 2022;21:306—18.
7.
Jack Jr CR, Andrews JS, Beach TG, Buracchio T, Dunn B, Graf A, et al. Revised criteria for diagnosis and staging of Alzheimer’s disease: Alzheimer’s Association Workgroup. Alzheimers Dement 2024;20:5143—69.
8.
Cheng GW, Xie AH, Yan Z, Zhu XZ, Song YF, Chen TK. Nanomedicines for Alzheimer’s disease: therapies based on pathological mechanisms. Brain-X 2023;1:e27.
9.
Mead S, Fox NC. Lecanemab slows Alzheimer’s disease: hope and challenges. Lancet Neurol 2023;22:106—8.
10.
Sebastian W, Richard M, Edo R, Shirley N, Carol B. Lecanemab for Alzheimer’s disease. BMJ 2022;379:o3010.
11.
Kakkar A, Traverso G, Farokhzad OC, Weissleder R, Langer R. Evolution of macromolecular complexity in drug delivery systems. Nat Rev Chem 2017;1:63.
12.
Burke JF, Kerber KA, Langa KM, Albin RL, Kotagal V. Lecanemab. Neurology 2023;101:661—5.
13.
Avgerinos KI, Ferrucci L, Kapogiannis D. Effects of monoclonal antibodies against amyloid-β on clinical and biomarker outcomes and adverse event risks: a systematic review and meta-analysis of phase III RCTs in Alzheimer’s disease. Ageing Res Rev 2021;68:101339.
14.
Kulkarni JA, Witzigmann D, Thomson SB, Chen S, Leavitt BR, Cullis PR, et al. The current landscape of nucleic acid therapeutics. Nat Nanotechnol 2021;16:630—43.
15.
Adams D, Gonzalez-Duarte A, O’Riordan WD, Yang CC, Ueda M, Kristen AV, et al. Patisiran, an RNAi therapeutic, for hereditary transthyretin amyloidosis. N Engl J Med 2018;379:11—21.
16.
Ledford H. Gene-silencing technology gets first drug approval after 20-year wait. Nature 2018;560:291—2.
17.
Singer O, Marr RA, Rockenstein E, Crews L, Coufal NG, Gage FH, et al. Targeting BACE1 with siRNAs ameliorates Alzheimer disease neuropathology in a transgenic model. Nat Neurosci 2005;8:1343—9.
18.
Wang PZ, Zheng XY, Guo Q, Yang P, Pang XY, Qian K, et al. Systemic delivery of BACE1 siRNA through neuron-targeted nanocomplexes for treatment of Alzheimer’s disease. J Control Release 2018;279:220—33.
19.
Yang XT, Yang WQ, Xia X, Lei T, Yang ZH, Jia WF, et al. Intranasal delivery of BACE1 siRNA and rapamycin by dual targets modified nanoparticles for Alzheimer’s disease therapy. Small 2022;18:2203182.
20.
Mei C, Zhan JB, Zhu SZ, Zhang YT, Xiong CE, Wang J, et al. Advances of therapy for Alzheimer’s disease: an updated review. Brain X 2024;2:e68.
21.
Korczyn AD, Grinberg LT. Is Alzheimer disease a disease?. Nat Rev Neurol 2024;20:245—51.
22.
Scheltens P, Blennow K, Breteler MMB, de Strooper B, Frisoni GB, Salloway S, et al. Alzheimer’s disease. Lancet 2016;388:505—17.
23.
Wang DY, Gu X, Ma XY, Chen J, Zhang QZ, Yu ZH, et al. Nanopolyphenol rejuvenates microglial surveillance of multiple misfolded proteins through metabolic reprogramming. Acta Pharm Sin B 2023;13:834—51.
24.
Yao L, Gu X, Song QX, Wang XL, Huang M, Hu M, et al. Nanoformulated alpha-mangostin ameliorates Alzheimer’s disease neuropathology by elevating LDLR expression and accelerating amyloid-beta clearance. J Control Release 2016;226:1—14.
25.
Horejs C. From lipids to lipid nanoparticles to mRNA vaccines. Nat Rev Mater 2021;6:1075—6.
26.
Ferhan AR, Park S, Park H, Tae H, Jackman JA, Cho NJ. Lipid nanoparticle technologies for nucleic acid delivery: a nanoarchitectonics perspective. Adv Funct Mater 2022;32:2203669.
27.
Liu R, Luo C, Pang ZQ, Zhang JM, Ruan SB, Wu MY, et al. Advances of nanoparticles as drug delivery systems for disease diagnosis and treatment. Chin Chem Lett 2023;34:107518.
28.
Wang Q, Jiang QK, Li D, Yang ZM, Gao L, Liu F, et al. Elaborately engineering of lipid nanoparticle for targeting delivery of siRNA and suppressing acute liver injury. Chin Chem Lett 2024;35:108683.
29.
Francia V, Schiffelers RM, Cullis PR, Witzigmann D. The biomolecular corona of lipid nanoparticles for gene therapy. Bioconjug Chem 2020;31:2046—59.
30.
Johnson LT, Zhang D, Zhou K, Lee SM, Liu S, Dilliard SA, et al. Lipid nanoparticle (LNP) chemistry can endow unique in vivo RNA delivery fates within the liver that alter therapeutic outcomes in a cancer model. Mol Pharmaceutics 2022;19:3973—86.
31.
Cheng Q, Wei T, Jia YM, Farbiak L, Zhou KJ, Zhang SY, et al. Dendrimer-based lipid nanoparticles deliver therapeutic FAH mRNA to normalize liver function and extend survival in a mouse model of hepatorenal tyrosinemia type I. Adv Mater 2018;30:1805308.
32.
Wei Y, Xia X, Li HM, Gao HL. Influence factors on and potential strategies to amplify receptor-mediated nanodrug delivery across the blood—brain barrier. Expert Opin Drug Deliv 2023;20:1713—30.
33.
Akita T, Kimura R, Akaguma S, Nagai M, Nakao Y, Tsugane M, et al. Usefulness of cell-penetrating peptides and penetration accelerating sequence for nose-to-brain delivery of glucagon-like peptide-2. J Control Release 2021;335:575—83.
34.
Sasaki K, Fukakusa S, Torikai Y, Suzuki C, Sonohata I, Kawahata T, et al. Effective nose-to-brain drug delivery using a combination system targeting the olfactory region in monkeys. J Control Release 2023;359:384—99.
35.
Huang QQ, Chen YK, Zhang WW, Xia X, Li HM, Qin M, et al. Nanotechnology for enhanced nose-to-brain drug delivery in treating neurological diseases. J Control Release 2024;366:519—34.
36.
Zhang SS, Li RQ, Chen Z, Wang XY, Dumont AS, Fan X. Immune cells: potential carriers or agents for drug delivery to the central nervous system. Mil Med Res 2024;11:19.
37.
Goel H, Kalra V, Verma SK, Dubey SK, Tiwary AK. Convolutions in the rendition of nose to brain therapeutics from bench to bedside: feats & fallacies. J Control Release 2022;341:782—811.
38.
Kanazawa T, Akiyama F, Kakizaki S, Takashima Y, Seta Y. Delivery of siRNA to the brain using a combination of nose-to-brain delivery and cell-penetrating peptide-modified nano-micelles. Biomaterials 2013;34:9220—6.
39.
Schaefer ML, Böttger B, Silver WL, Finger TE. Trigeminal collaterals in the nasal epithelium and olfactory bulb: a potential route for direct modulation of olfactory information by trigeminal stimuli. J Comp Neurol 2002;444:221—6.
40.
Hinge NS, Kathuria H, Pandey MM. Engineering of structural and functional properties of nanotherapeutics and nanodiagnostics for intranasal brain targeting in Alzheimer’s. Appl Mater Today 2022;26:101303.
41.
Raghav M, Gupta V, Awasthi R, Singh A, Kulkarni GT. Nose-to-brain drug delivery: challenges and progress towards brain targeting in the treatment of neurological disorders. J Drug Deliv Sci Technol 2023;86:104756.
42.
Han XX, Gong NQ, Xue LL, Billingsley MM, El-Mayta R, Shepherd SJ, et al. Ligand-tethered lipid nanoparticles for targeted RNA delivery to treat liver fibrosis. Nat Commun 2023;14:75.
43.
Elzoghby AO, Abdelmoneem MA, Hassanin IA, Abd Elwakil MM, Elnaggar MA, Mokhtar S, et al. Lactoferrin, a multi-functional glycoprotein: active therapeutic, drug nanocarrier & targeting ligand. Biomaterials 2020;263:120355.
44.
Hu KL, Shi YB, Jiang WM, Han JY, Huang SX, Jiang XG. Lactoferrin conjugated PEG-PLGA nanoparticles for brain delivery: preparation, characterization and efficacy in Parkinson’s disease. Int J Pharm 2011;415:273—83.
45.
Liu ZY, Jiang MY, Kang T, Miao DY, Gu GZ, Song QX, et al. Lactoferrin-modified PEG-co-PCL nanoparticles for enhanced brain delivery of NAP peptide following intranasal administration. Biomaterials 2013;34:3870—81.
46.
Tang SN, Wang AP, Yan XJ, Chu LX, Yang XC, Song YN, et al. Brain-targeted intranasal delivery of dopamine with borneol and lactoferrin co-modified nanoparticles for treating Parkinson’s disease. Drug Deliv 2019;26:700—7.
47.
Jiang RL, Lopez V, Kelleher SL, Lönnerdal B. Apo- and holo-lactoferrin are both internalized by lactoferrin receptor via clathrin-mediated endocytosis but differentially affect ERK-signaling and cell proliferation in caco-2 cells. J Cell Physiol 2011;226:3022—31.
48.
Xia X, Wei Y, Huang QQ, Zhou Y, Wang XR, Shi YL, et al. Counteracting Alzheimer’s disease via normalizing neurovascular unit with a self-regulated multi-functional nano-modulator. Acta Pharm Sin B 2024;14:5464—78.
49.
Sanchez-Guzman D, Boland S, Brookes O, Mc Cord C, Lai Kuen R, Sirri V, et al. Long-term evolution of the epithelial cell secretome in preclinical 3D models of the human bronchial epithelium. Sci Rep 2021;11:6621.
50.
Huang QQ, Jiang CQ, Xia X, Wang YF, Yan C, Wang XR, et al. Pathological BBB crossing melanin-like nanoparticles as metal-ion chelators and neuroinflammation regulators against Alzheimer’s disease. Research 2023;6:180.
51.
Wang XR, Chen SQ, Xia X, Du YF, Wei Y, Yang WQ, et al. lysosome-targeting protein degradation through endocytosis pathway triggered by polyvalent nano-chimera for AD therapy. Adv Mater 2024;37:2411061.
52.
Yang WQ, Shi YL, Zhang YW, Yang YT, Du YF, Yang ZX, et al. Intranasal carrier-free nanomodulator addresses both symptomatology and etiology of Alzheimer’s disease by restoring neuron plasticity and reprogramming lesion microenvironment. ACS Nano 2024;18:29779—93.
53.
Lei T, Yang ZX, Jiang CQ, Wang XR, Yang WQ, Yang XT, et al. Mannose-integrated nanoparticle hitchhike glucose transporter 1 recycling to overcome various barriers of oral delivery for Alzheimer’s disease therapy. ACS Nano 2024;18:3234—50.
54.
Habib N, McCabe C, Medina S, Varshavsky M, Kitsberg D, Dvir-Szternfeld R, et al. Disease-associated astrocytes in Alzheimer’s disease and aging. Nat Neurosci 2020;23:701—6.
Year 2025 volume 15 Issue 6
PDF
53
30
Cite this Article
BibTeX
Article Info
doi: 10.1016/j.apsb.2025.02.035
  • Receive Date:2025-01-14
  • Online Date:2026-04-03
Article Data
Affiliations
History
  • Received:2025-01-14
  • Revised:2025-02-24
  • Accepted:2025-02-26
Affiliations
    aSchool of Public Health, Chengdu Medical College, Chengdu 610500, China
    bKey Laboratory of Drug-Targeting and Drug Delivery System of the Education Ministry and Sichuan Province, Sichuan Engineering Laboratory for Plant-Sourced Drug and Sichuan, Research Center for Drug Precision Industrial Technology, West China School of Pharmacy, Sichuan University, Chengdu 610041, China
    cSchool of Food and Biological Engineering, Chengdu University, Chengdu 610106, China

Corresponding:

* Corresponding authors.
References
Share
https://castjournals.cast.org.cn/joweb/apsb/EN/10.1016/j.apsb.2025.02.035
Share to
QR

Scan QR to access full text

Cite this article
BibTeX
Citations
表12种不同金属材料的力学参数

Family
属数
Number of
genus
种数
Number of
species
占总种数比例
Percentage of
total species (%)

Genus
种数
Number of
species
占总种数比例
Percentage of total
species (%)
鹅膏菌科Amanitaceae 2 11 5.26 鹅膏菌属 Amanita 10 4.78
小菇科 Mycenaceae 2 12 5.74 丝盖伞属 Inocybe 5 2.39
多孔菌科 Polyporaceae 8 14 6.70 蜡蘑属 Laccaria 5 2.39
红菇科 Russulaceae 3 23 11.00 小皮伞属 Marasmius 6 2.87
小菇属 Mycena 11 5.26
光柄菇属 Pluteus 5 2.39
红菇属 Russula 17 8.13
栓菌属 Trametes 5 2.39
关闭全屏
  • BibTeX
  • EndNote
  • RefWorks
  • TxT