Ten species of microalgae (Asterionellopsis glacialis, Chattonella marina, Chaetoceros curvisetus, Eucampia zodiacus, Heterosigma akashiwo, Leptocylindrus danicus, Prorocentrum minimum, Scrippsiella trochoidea, Skeletonema marinoi, and Thalassiosira nordenskioeldii) were collected in Tongyeong, and cultivated at the Korea Institute of Ocean and Science Technology (KIOST) in Geoje, Korea. Cochlodinium polykrikoides was obtained from the Library of Marine Samples in KIOST and H. triquetra was from a laboratory at KIOST (Baek et al., 2011). All 12 species were cultured in f/2 medium with salinity 30 at 20°C under 12 h light-dark cycle.

RNA was extracted according to a modification of the method described by Venugopalan and Kapoor (Venugopalan and Kapoor, 1997), and was used to produce cDNA using the GoScript^TM Reverse Transcription System (Promega, Madison, WI, USA). The LSU rDNA genes were subjected to PCR with a pair of primers (forward 5′-CGGAGGAAAAGAAACTAAC, reverse 5′-AGCTACTAGATGGTTCGAT) (Zhen et al., 2007). PCR amplification was conducted using a 20 μL reaction mixture that contained 2 μL of 10× reaction buffer, 2 μL of 2.5 mmol/L dNTPs, 2.5 units of Taq DNA polymerase (TaKaRa, Japan), 1 μL of 30 ng/μL total DNA, and 1 μL each of 10 μmol/L forward primer and reverse primer. The PCR amplification protocol was 10 min at 94°C, 35 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, and then a 5 min extension at 72°C. The PCR products were separated by 1% agarose gel electrophoresis, and then purified using the MEGA-spin^TM Agarose Gel DNA Extraction Kit (Intron, Korea). Products were then cloned into the pGEM-T-Easy Vector (Promega, Madison, WI, USA) and used for transformation of E. coli DH5α cells. LSU rRNA genes were sequenced by Bioneer Corporation (Daejeon, South Korea), and sequences were analyzed using DNAstar and MEGA6 software.

The sequenced LSU rDNA of H. triquetra was confirmed by search of BLASTn (http://www.ncbi.nlm.nih.gov/Blast.cgi). Then, the sequences of all 12 species were aligned, using Clustal W in MEGA6, and the most variable regions were identified for use in making an NPA probe for H. triquetra. Three probes were designed: a ~60-mer NPA probe targeting LSU rRNA; a 25-mer capture probe that was labeled with biotin at the 5′ end and had a 3′ terminal region that was complementary to the NPA probe; and a 25-mer signal probe that was labeled with fluorescein at the 3′ end and was complementary to the 5′ terminal region of the NPA probe. The NPA probe for H. triquetra was 5′-CCACGCTTGCGCTGAAGCAGCAGGCAATCACATTAGCACGCACCAATCTTGCCAAGAAGC; the capture probe was 5′-biotin-GCTTCTTGGCAAGATTGGTGCGTGC; and the signal probe was 5′-GCCTGCTGCTTCAGCGCAAGCGTGG-fluorescein (Table 1). All probes were chemically synthesized by Bioneer Corporation (Daejeon, Korea). The NPA-SH analysis was modified from Cai et al. (2006) (Zhen et al., 2007). Cultured H. triquetra were collected in a 1.5 mL Eppendorf tube after centrifugation to remove growth medium. Then, 950 μL of lysis buffer (80% formamide, 450 mmol/L NaCl, 5 mmol/L Na₂EDTA, 1 mg/mL yeast tRNA, 1% SDS, pH 6.4) and 50 μL of 10 mg/mL yeast t-RNA was added, and the sample was sonicated for 10 s with 50% duty cycle and 450 W output sets. The sample was centrifuged again to precipitate cell debris. Then, 30 μL of lysate, 3 μL of NPA probe solution (500 nmol/L NPA probes in lysis buffer), and 50 μL of mineral oil were mixed in a 1.5 mL Eppendorf tube. The sample was denatured at 98°C for 5 min and then cooled to room temperature to allow hybridization of the NPA probe with the 28S rRNA. Then, 30 μL of S1 nuclease mix was added (60 units S1 nuclease in 1.4 mol/L sodium chloride, 22.5 mmol/L zinc sulfate, 250 mmol/L sodium acetate, pH 4.5) (Promega, USA), and the sample was incubated for 1 h at 42°C to restrict non-hybridized regions. The reaction was stopped by adding 150 μL of a nuclease stop solution (62.5 mmol/L sodium hydroxide, 30 mmol/L EDTA, and 1× phosphate-buffered saline (PBS), pH 7.2). The mixture was then denatured at 98°C for 5 min, and used before it had cooled. The sample was coated with biotin-labeled capture probes in a 96-well streptavidin-coated microplate (Pierce Biotechnology, Inc. Rockford, IL.), with each well containing 100 μL of S1 nuclease-treated sample. The plate was cooled to room temperature for 5 min, washed three times with PBS and 0.5% Tween-20. Each well was filled with 100 μL of 5 nmol/L signal probes in a hybridization buffer (4× SSC, 10% formamide, 0.02% SDS pH 7.2), and the plate was incubated at 50°C for 20 min with shaking (130 r/min). After washing three times with PBST (3.2 mmol/L Na₂HPO₄, 0.5 mmol/L KH₂PO₄, 1.3 mmol/L KCl, 135 mmol/L NaCl, 0.5% Tween20, pH 7.4), 100 μL of an anti-fluorescein-POD (Roche, USA, 1:6 000 dilution in PBS, 2% goat serum) was added to each well. Then, the plate was incubated at 37°C for 10 min, and washed three times with PBS. Finally, 100 μL/well of 3, 3′, 5, 5′-tetramethylbenzidine (TMB, Sigma, USA) substrate was added, and the sample was incubated at 37°C for 10 min to allow blue color development. The reaction was stopped by adding 50 μL of 2 mol/L H₂SO₄ per well, causing the color to change to yellow. Absorbance was measured at 450 nm and 620 nm using a plate reader (FLUOstar, BMG Thermo Fisher Scientific Inc, USA) and the A_{450 nm}/A_{620 nm} ratio was calculated.

The specificity was checked with six cultured microalgae: C. marina, C. polykrikoides, H. triquetra, H. akashiwo, P. minimum, and S. trochoidea. The sensitivity was tested by counting H. triquetra under light microscopy using serial dilutions. Three replicates of each dilution were analyzed. The absorbance of NPA-SH and microscopic data were compared.

Natural seawater was collected monthly near Tongyeong, Korea (34°45′97.58′′N, 128°22′54.62′′E) from January to December 2014 (Jan. 24, Feb. 14, Mar. 10, Apr. 9, May 15, Jun. 19, Jul. 22, Aug. 27, Sep. 19, Oct. 16, Nov. 18, and Dec. 11). Samples were collected in surface seawater (1 L) using a net with a pore size of 0.2 μm. At the same time, water temperature, salinity, pH, and dissolved oxygen (DO) were measured by YSI instrument. The sample was immediately placed on ice, and then carried to the laboratory. Then, the sample was centrifuged at 3 000 r/min for 10 min, the supernatant was removed, and the pellet was stored at –70°C until use. Stored samples were used for the H. triquetra NPA-SH assay. Only lysis buffer and yeast t-RNA were added to the frozen samples, and the samples were sonicated for lysis of microalgae, using the same parameters as for NPA-SH lysis.

NPA-SH assay was performed at least three times in quadruplicate for each experiment. All data were presented as means±SE. A student’s t-test was performed to test differences between controls and each experimental group.

We isolated total RNA of microalgae that are responsible for red tides (C. marina, C. polykrikoides, H. triquetra, H. akashiwo, P. minimum, and S. trochoidea), and of which the most abundant species were near Tongyeong (A. glacialis, C. curvisetus, E. zodiacus, L. danicus, S. marinoi, and T. nordenskioeldii). Then, we analyzed the LSU sequences of all species to design H. triquetra species-specific probes for NPA-SH. The results show the signals of sixmicroalgae samples, a negative control, and a mixed sample of C. marina, C. polykrikoides, H. triquetra, H. akashiwo, P. minimum, and S. trochoidea (Fig. 1). The signal of each sample (A_{450 nm}/A_{620 nm}) expressed relatively to the negative control. Heterocapsa triquetra had the strongest signal (1.59), consistent with its yellow color, and all the other samples had signals less than 1.06. This result means that the H. triquetra NPA-SH oligonucleotide probe can distinguish H. triquetra from five other microalgae that are also responsible for red tides.

We tested probe sensitivity by measuring the signal with different numbers of cells (Fig. 2). The results show that the signal was above baseline when the cell concentration was 1.5×10⁴ cells/mL (Fig. 2). This is lower than 3.0×10⁴ cells/mL standard threshold for a red-tide warning issued by the Korea Ministry of Oceans and Fisheries in 2015. We also established a standard curve for the range of 3.0×10³ to 1.5×10⁵ cells/mL. The least-squares linear regression equation was y=0.526 4x+0.353 5, r²=0.893 2 (Fig. 2).

Finally, we tested the NAP-SH method using field samples collected from natural seawater near Tongyeong, in the southern sea area of Korea (Fig. 3). We analyzed three samples per month from January to December of 2014. Based on the standard regression equation above, the A_{450 nm}/A_{620 nm} value of 1.11 in September corresponds to 2 874 cells/mL, and the A_{450 nm}/A_{620 nm} value of 1.23 in December corresponds to 3 330 cells/mL. All other months had no detectable H. triquetra (Fig. 4).