收藏切换
Isolation, distribution and evaluation of cytotoxic and antioxidant activity of cultivable actinobacteria from the Oman Sea sediments
收藏切换
PDF
Mohsen Gozari1, 2, *, Nima Bahador1, Amir Reza Jassbi3, Mohammad Seddiq Mortazavi2, Samad Hamzehei4, Ebrahim Eftekhar5
Acta Oceanologica Sinica | 2019, 38(12) : 84 - 90
Less
收藏切换
Acta Oceanologica Sinica | 2019, 38(12): 84-90
Marine Biology
Isolation, distribution and evaluation of cytotoxic and antioxidant activity of cultivable actinobacteria from the Oman Sea sediments
Full
Mohsen Gozari1, 2, *, Nima Bahador1, Amir Reza Jassbi3, Mohammad Seddiq Mortazavi2, Samad Hamzehei4, Ebrahim Eftekhar5
Affiliations
  • 1 Department of Microbiology, College of Science, Agriculture and Modern Technology, Shiraz Branch, Islamic Azad University, Shiraz 71331, Iran
  • 2 Persian Gulf and Oman Sea Ecological Research Center, Iranian Fisheries Science Research Institute (IFSRI), Agricultural Research, Education and Extension Organization (AREEO), Bandar Abbas 79131, Iran
  • 3 Medicinal and Natural Products Chemistry Research Center, Shiraz University of Medical Sciences, Shiraz 71331, Iran
  • 4 Iranian National Institute of Oceanography and Atmospheric Science, Tehran 1414, Iran
  • 5 Molecular Medicine Research Center, Hormozgan Health Institute, Hormozgan University of Medical Sciences, Bandar Abbas 79131, Iran
Published: 2019-12-25 doi: 10.1007/s13131-019-1515-2
Outline
收藏切换

Screening bioactive natural products from bacteria is a determinative step in the drug discovery programs. The present study aim to isolate actinobacteria from the Oman Sea sediments for determining the effects of different culture media and treatments on the yield of the isolation process, and measure the DPPH radical scavenging and Artemia cytotoxic activity of culture extracts of the actinobacterial isolates. A total of 290 actinobacterial isolates were collected from 14 sediment samples. Heat treatment (40.68%) and M4 medium (29.31%) exhibited the maximum isolation rates of actinobacteria. Streptomyces isolates were dominantly distributed in all of the investigated stations according to 16S rRNA gene sequencing. The distribution pattern of Streptomyces followed a depth-dependent frequency trend, whereas the members of rare genera including Micromonospora, Nocardia Actinoplanes, Nocardiopsis, Saccharopolyspora and Crossiella were distributed in deeper stations. Approximately, 25% of the examined isolates could scavenge 90% of 10–4 mol/L DPPH solutions at 1 250 μg/mL final concentration of their ethyl acetate culture extracts. Furthermore, the most potent extracts could scavenge DPPH radicals with IC50 ranges from 356.8 to 566.4 μg/mL. Brine shrimp cytotoxicity tests showed that 38.88% of the examined culture extracts exhibited LC50 lower than 1 000 μg/mL against the Artemia cells. Moreover, the most potent culture extracts exhibited LC50 range from 335.4 to 534.4 μg/mL. Phylogenetic analysis by 16S rRNA gene sequence revealed that the OS 005, OS 263 and OS 157 closely related to Streptomyces djakartensis, Streptomyces olivaceus and Nocardiopsis dassonvillei respectively. These results suggested the widespread distribution of the antioxidant and cytotoxic producing actinobacteria in the Oman Sea sediments, which could be considered as promising candidates for the discovery of microbial bioactive compounds.

antioxidant activity  /  cytotoxic activity  /  marine actinobacteria  /  Oman Sea  /  phylogenetic analysis
Mohsen Gozari, Nima Bahador, Amir Reza Jassbi, Mohammad Seddiq Mortazavi, Samad Hamzehei, Ebrahim Eftekhar. Isolation, distribution and evaluation of cytotoxic and antioxidant activity of cultivable actinobacteria from the Oman Sea sediments[J]. Acta Oceanologica Sinica, 2019 , 38 (12) : 84 -90 . DOI: 10.1007/s13131-019-1515-2
Actinobacteria are gram positive and high G+C content bacteria that form the largest phylum in the bacterial domain. Moreover, they are considered as the most important bacteria in microbial biotechnology (Manivasagan et al., 2014). They also have produced the maximum percentage of bioactive/non-bioactive constituents (47.01%) that is more than the average proportion among the whole marine organisms (28.39%) (Olano et al., 2009). These fascinating characteristics attracted the attention of researchers to isolate actinobacteria from marine habitats especially from sponges, corals, mangroves and sediments for their therapeutic compounds (Gozari et al., 2019a; Mahmoud and Kalendar, 2016; Ser et al., 2017). Some of the cytotoxic agents that produced by sediments inhabiting actinobacteria are salinosporamide A, carpatamides, daryamides and pyridinium (Asolkar et al., 2006; Dasari et al., 2012; Fenical et al., 2009; Fu et al., 2014). In addition, the secondary metabolites of marine actinobacteria were also reported as potent antioxidant agents. For instance, Streptomyces malaysiense sp. strain MUSC 136 isolated from mangrove forest soil showed DPPH radical scavenging activity with inhibition percentage of 27.24% at 2 mg culture extract per milliliter of 0.016% DPPH solution (Ser et al., 2016). Since the adaptation to harsh environmental conditions in marine microenvironments could promote genetic changes in the actinobacteria, new biosynthesis pathways could develop for unique bioactive compounds to cope with these conditions (Gontang et al., 2010; Zotchev et al., 2017). Hence, isolation and preservation of the actinobacteria from a less-discovered environment such as the Oman Sea are essential to conserve their valuable biotechnological potentials. The Oman Sea is a part of the Indian Ocean that has various environmental conditions with particular hydrological pattern and its sediments derived from different sources (Karamouz et al., 2012), which rarely has been explored for the sediment inhabiting actinobacteria. Consequently, the main goal of the present investigation was the selective isolation of the actinobacteria from the Oman Sea sediments. Various sample treatments and culture media were used to increase the recovery rate of the cultivable actinobacteria. The antioxidant and cytotoxic activity of the isolated actinobacterial populations in the sediments were measured, and the most potent isolates were identified genetically.
Marine sediment samples were collected from 14 locations along the northern part of the Oman Sea in Hormozgan Province, Iran in December 2015. The exploration area was located between longitudes 57° to 59°30′E and latitudes 25° to 27°N. Depth and position of each station were recorded (Fig. 1). A Van Veen Grab sampler (Hydro-bios, Germany) was used for collecting sediments samples. The collected samples were transferred to 50 mL sterile collection vials, and kept refrigerated until processing (usually within 24 h) (Maldonado et al., 2009). The depth of sampling stations and some physicochemical properties of water were recorded by CTD system.
Five physical and one chemical treatments were applied to the samples. Heat treatment was applied by incubating the diluted samples at 50°C in water bath for 1 h (Hameş-Kocabaş and Uzel, 2012). Desiccation treatment was done by drying samples under laminar flow for 2 weeks (Jensen et al., 2005). Sediment samples were irradiated by UV 254 nm at 20 cm distance on the samples for 30 s in a UV chamber (Bredholt et al., 2007). Ultrasonic treatment of the samples was taken in an ultrasonic bath with 40 kHz power for 2 min and at 30°C (Qiu et al., 2008). Sediments samples were treated at –21°C for 24 h in a freezer for the freezing treatment (Jensen et al., 2005). Chemical treatment was done by adding 1.5% phenol in the final sample solution and incubated at 30°C for 30 min (Bredholt et al., 2008).
A total of 200 µL of serially diluted samples (10–1, 10–2, 10–3, 10–4) in sterilized seawater were inoculated in the following culture media. M1 (1% starch, 0.03% casein, 0.2% KNO3, 0.2% K2HPO4, 0.005% MgSO4·7H2O, 0.002% CaCO3, 0.001% FeSO4·7H2O, 1.8% agar in filtered seawater), M2 (0.5% peptone, 0.1% yeast extract, 0.08% MgCl2, 0.6% CaCl2, 1.5% agar in filtered seawater), M3 (10% aqueous extract of marine sediments, 1.5% agar in filtered seawater), M4 (0.5% glucose, 0.1% asparagine, 0.1% K2HPO4, 1.8% agar in filtered seawater), M5 (1.8% agar in filtered seawater) and M6 (0.5% glycerol, 0.1% arginine, 0.1% K2HPO4, 1.8% agar in filtered seawater). All the isolation media were supplemented with 100 mg/L cycloheximide and 25 mg/L nalidixic acid. Inoculated media were incubated at 28°C and examined for growth up to 4 weeks.
All of the colonies were preliminary characterized based on macromorphological properties including color, shape, size and the form of colonies and micromorphological description such as shape and arrangements of the isolates in Gram staining (Whitman et al., 2012). Finally, the distinct isolates were selected for identification by 16S rRNA sequencing.
The purified distinct isolates were inoculated in 100 mL M2 medium and incubated in a shaking incubator at 28°C and 220 r/min. After the five days of the incubation, the filtered fermentation broths were extracted with equal volume of ethyl acetate twice (1:1, v/v) and evaporatedin rotary evaporator. The culture extracts of the distinct isolates were examined for antioxidant and cytotoxic activity after concentration and preparation (Seidel, 2006).
The DPPH radical scavenging activity of the culture extracts of the distinct isolates was determined by the microdilution method at the final concentration of 1 250 µg/mL (Gozari et al., 2018; Leong and Shui, 2002). IC50 of the most potent isolates with >90% scavenging activity was determined at seven final concentration (1 250, 625, 312, 156, 78, 39, 19.5 µg/mL). Five microliters of each primary concentration were added to 195 µL DPPH solution at 100 µmol/L concentration in methanol. The 96 well microplates were incubated at room temperature in the dark for 30 min. The absorbance of samples was measured by Microplate Reader (BioTech instrument) at 517 nm. Ascorbic acid was taken as the positive control. The scavenging activity (%) of the samples was calculated by the following equation:
${\rm{scavenging}}\;{\rm{activity }} = ({I_0} - {I_{\rm{s}}}/{I_0}) \times {\rm{ }}100\% ,$
where I0 is the absorbance of the untreated DPPH solution, and Is is the absorbance of the samples or the standard control in the DPPH solution.
Cytotoxic activity of the culture extracts of the distinct isolates was assayed by brine-shrimp microwell cytotoxicity method (Atta-ur-Rahman et al., 2001). One gram of Artemia franciscana cysts (INVE TM) was inoculated in 2 L filtered seawater with salinity 30 and incubated at 22–29°C under white light for 48 h. After the collection of nauplii cells, 100 µL nauplii suspension (10–15 nauplii/100 µL) was added to 100 µL extracts at 1 000 µg/mL in each 96-well microplate and incubated at 25°C for 24 h. The number of live and dead nauplii was recorded and potent extracts were determined. LC50 of the most potent isolates with >90% cytotoxic activity was determined at lower concentration (500, 250, 125 and 62.5 µg/mL) by the following equation:
${\rm{cytotoxic}}\;{\rm{activity}} = ({N_{{\rm{control}}}}-{N_{{\rm{test}}}}/{N_{{\rm{control}}}}) \times 100\% ,$
where Ntest is the number of live nauplii at treated well, and Ncontrol is the number of live nauplii at untreated well.
Extraction of genomic DNA of the distinct isolates was performed based on CTAB method defined by Kieser et al. (2000). The 16S rRNA gene was amplified through PCR reaction using 16S universal primers 27F (5′ to 3′AGAGTTTGATCCTGGCTCAG) and 1492R (5′ to 3′ACGGCTACCTTGTTACGA). The thermal cycles were optimized as follow: (95°C for 4 min, 95°C for 1 min, 60°C for 1 min and 72°C for 2 min) × 35 cycles followed by final extension at 72°C for 10 min. The amplified PCR products were purified by Qiaquick PCR purification kit (QIAGEN, USA). Consequently, the 16S rRNA gene was sequenced by Macrogen Company (Seoul, Korea and were analyzed using the BLAST program at NCBI (National Centre for Biotechnology Information) server (Madden, 2013). Phylogenetic analyses of the 16S rRNA gene of the distinct isolates were constructed using neighbor joining algorithm (Saitou and Nei, 1987) with MEGA 7 program (Kumar et al., 2016). The 16S rRNA gene sequences were registered to NCBI GenBank database.
All the experiments were performed in triplicates. The results of the bacterial isolation were reported as the percentage of the Streptomyces-like/non-Streptomyces-like isolates to the whole actinobacterial isolates. The antioxidant potential and artemia cytotoxicity assay presented as mean IC50 and LC50 ± standard error (SE), respectively. The LC50 and IC50 values of the extracted metabolites and their 95% confidence intervals were determined using the non-linear regression by GraphPad PRISM version 6 (GraphPad Software, San Diago, CA). The levels of statistical significance (p<0.05) of the data were calculated with oneway ANOVA followed by LSD using SPSS program (Version 24). The topology of the resultant phylogenetic tree was evaluated by bootstrap resampling with 1 000 replicates (Felsenstein, 1985) with MEGA7.
Overall, 290 isolates of the actinobacteria were derived from 14 sediment samples throughout the northern parts of the Oman Sea in Hormozgan Province, Iran. The actinobacterial isolates were widely spread along the exploration area, especially in the samples collected from Stas 5, 6, 7, 8, 10, 11 and 12 (Fig. 2). Moreover, preliminary characterization exhibited that the Streptomyces-like isolates were dominant in most of the stations. Among the selected isolation media, M4 medium significantly resulted in the growth of the highest number of actinobacterial isolates (29.31%), while M6, M1, M3, M2 and M5 media yielded 21.72, 18.96, 14.13, 10.34 and 5.51% of the isolates respectively. Most of the isolated colonies in different media belonged to Streptomyces-like isolates (Fig. 3). Comparison of sample treatment performances revealed that heat treatment recovered 40.68% of the actinobacterial isolates at all the culture media and significantly exhibited more efficiency than drying (17.93%), UV (13.10%), phenol (10.68%), freezing (3.79%) and sonication (3.44%) treatments (Fig. 4). Furthermore, Streptomyces-like isolates were predominant in heat (64.40%), UV (63.15%), drying (61.53%) treatments, whereas freezing (45.45%), sonication (40%) and phenol (3.22%) treatments promoted the non-Streptomyces-like isolates (Fig. 4). According to our preliminary characterization results, 36 distinct isolates were selected for bioassay experiments. The results of antioxidant activity showed that 69.44% extracts of distinct isolates could scavenge more than 50% of DPPH radicals at 1 250 µg/mL. While 25% of them showed more than 90% scavenging activity. The IC50 values of the crude extracts of the most potent isolates varied from 356.8 to 566.4 µg/mL (Table 1). Cytotoxicity assay revealed that 13.88% of the distinct isolates showed more than 90% cytotoxic activity against Artemia franciscana nauplii at 1 000 µg/mL. The crude extracts of the most potent isolates exhibited LC50 values ranged from 335.4 to 534.4 µg/mL (Table 2). Analysis of the 16S rRNA gene sequences of 36 distinct isolates confirmed that Streptomyces with 25 strains established dominant group in the structure of the actinobacterial community. However, rare actinobacteria including Micromonospora (3 strains), Nocardia (3 strains), Actinoplanes (2 strains), Nocardiopsis (1 strain), Saccharopolyspora (1 strain) and Crossiella (1 strain) were isolated especially from deeper stations. The phylogenetic analysis showed different similarity values between the most potent strains and their closest type strains. So that, the Streptomyces sp. strain OS 005, Streptomyces sp. strain OS 263 and Nocardiopsis sp. strain OS 157 showed 99%, 98% and 97% similarity with Streptomyces djakartensis strain NBRC 15409, Streptomyces olivaceus strain NBRC 12805 and Nocardiopsis dassonvillei subsp. albirubida strain NBRC 13392 respectively. The neighbor-joining tree showed that the distinct isolates clustered separately in different clades. The Actinoplanes strains formed shared clade with the strains of Micromonospora, which located in different clusters. The Streptomyces strains located in a big clade and the strains of Nocardia, Saccharopolyspora and Crossiella located in different clusters of a same clade (Fig. 4).
Recovery of the highest rate of biodiversity and frequency of the actinobacterial isolates from less-explored environments can maximize hit rate to find unique bioactive strains (Zotchev et al., 2017). For this purpose, a combination of isolation media and treatments were implemented to describe the distribution pattern of cultivable actinobacteria in the exploration area. This pattern revealed that actinobacterial populations frequently distributed in the shallowest and nearshore stations. Moreover, Streptomyces-like isolates followed by a depth dependent frequency pattern (Fig. 2). Hence, the number of Streptomyces-like isolates decreased with increasing distance from shore. In spite of the fact that environmental factors could be shaped structure of bacterial community in marine sediments, our results showed that the observed distribution pattern of actinobacteria could not be influenced by environmental factors. Our results revealed that pH, salinity, oxygen and temperature did not show drastic variation between all stations (Table 3). In particular, variation of these environmental parameters in the deeper stations cannot limit the distribution of Streptomyces compared with other actinomycetes. Accordingly, this depth dependent pattern could be influenced by runoff currents such as the Jagin, Minab, Gabrik, Sadij Rivers and seasonal streams that carry terrestrial material including high frequency of Streptomyces. The higher prevalence of Streptomyces in terrestrial environments rather marine environments was previously approved (Kurtbӧke, 2017). Therefore, runoff sedimentation can influence the distribution pattern of Streptomyces in coastal sediments, although other factors should also be considered. These findings are consistent with the reported distribution pattern of actinobacteria in marine sediments of the Oman Sea, Trondheim Fjord, Persian Gulf and Bahamas (Bredholt et al., 2008; Gozari et al., 2016b; Gozari et al., 2019b; Jensen et al., 1991). The results of selective isolation process showed that M4 medium recovered the highest frequency of actinobacterial isolates, although M3 (56.09%) and M5 (62.50%) media exhibited high isolation rate of the non-Streptomyces-like isolates that might be because of their low organic content and their close composition to the marine environment. Hence, many of the undesired fast growing bacteria could not grow on the above mentioned minimal media (Doelle, 2014; Mann and Lazier, 2013). Among the treatments, heating could remove fast growing temperature-sensitive bacteria in the favor of actinobacterial isolates. The efficiency of heat treatment to maximize the isolation rate of actinobacteria was also shown in other studies (Gozari et al., 2016a; Jensen et al., 2005; Mincer et al., 2005). The selective performance of phenol treatment in the isolation of non-Streptomyces like isolates is due to the destruction of polyamide polymers in the protein structures of Streptomyces by phenol, while many of the non-Streptomyces isolates show lower sensitivity to phenol due to their lipid-rich cell wall (Istianto et al., 2012). Qiu et al. (2008) have reported the selective effect of phenol treatment in favor of Micromonospora species. Antioxidant activity screening of the culture extracts of the bacteria revealed the high potential of DPPH radical scavenging activity of the isolated actinobacteria. Recent studies showed that the presence of oil pollutants such as polyaromatic hydrocarbons (PAHs), heavy metals and xenobiotics increases the levels of oxidative pressure in marine sediments. Consequently, the marine sediments inhabiting organisms increase their antioxidant activity to neutralize this pressure (Solan and Whiteley, 2016). Determination of antioxidant activity of the most potent isolates indicated that the OS 157 culture extract exhibited the highest activity with IC50 value of 356.8 µg/mL (Table 1). In this regard, Lee and his colleagues showed that ethyl acetate culture extract of the Streptomyces sp. strain MJM 10778 could scavenge DPPH radicals with IC50 value of 92.8 µg/mL (Lee et al., 2014). In another study, the crude extract of the Streptomyces sp. LK-3 showed DPPH scavenging activity with IC50 value of 41.09 µg/mL (Karthik et al., 2013). The results of cytotoxic activity screening showed that 38.88% extracted secondary metabolites from the distinct isolates exhibited LC50 ≤1 000 µg/mL. Therefore, these results approved their bioactivity according to accepted criteria (Meyer et al., 1982). In this context, the study of Kesavan (2015) showed that 13.46% isolated actinobacteria from marine sediments represented LC50 value lower than 1 000 µg/mL by brine shrimp cytotoxicity assay. The result of our study showed that the extracted secondary metabolites from OS 157 isolate exhibited maximum cytotoxic activity with LC50 value of 335.4 µg/mL (Table 2). In another study, the extracted metabolites from Streptomyces sp. strain CAS isolated from marine sediments exhibited LC50 value of 23.5 µg/mL against Artemia nauplii (Palaniappan et al., 2013). Phylogenetic analysis demonstrated that there were significant evolutionary distances between selected potent strains and their closest type strains. Therefore, these putative strains might have undergone mutations in the 16S rRNA gene during the adaptation process with the microenvironments in marine sediments (Orr, 2005). Accordingly, their biosynthetic gene clusters also might be encountered mutation that led to the development of the new biosynthetic pathways and, consequently, the novel bioactive compounds. In conclusion, we have introduced a selective isolation process, including media and treatments that could exploit frequent and diverse taxonomic groups of marine actinobacteria. This study revealed the distribution pattern and diversity of actinobacterial populations in the north part of the Oman Sea sediments in Hormozgan Province, Iran and represented promising strains for the discovery of cytotoxic and antioxidant agents.
This research article is a part of the PhD thesis “Evaluation, identification and structure elucidation of cytotoxic and antioxidant secondary metabolites from Persian Gulf and Oman Sea derived Actinobacteria”. We thank the Persian Gulf and Oman Sea Ecological Research Institute for providing laboratory facilities and organizing the cruise program.
Asolkar R N, Jensen P R, Kauffman C A, et al. 2006. Daryamides A-C, weakly cytotoxic polyketides from a marine-derived actinomycete of the genus Streptomyces strain CNQ-085. Journal of Natural Products, 69(12): 1756–1759, doi: 10.1021/np0603828
Atta-ur-Rahman, Choudhary M I, Thomsen W J. 2001. Bioassay Techniques for Drug Development. Amsterdam: Harwood Academic Publishers, 8–12
Bredholt H, Galatenko O A, Engelhardt K, et al. 2007. Rare actinomycete bacteria from the shallow water sediments of the Trondheim fjord, Norway: isolation, diversity and biological activity. Environmental Microbiology, 9(11): 2756–2764, doi: 10.1111/j.1462-2920.2007.01387.x
Bredholt H, Fjærvik E, Johnsen G, et al. 2008. Actinomycetes from sediments in the Trondheim fjord, Norway: diversity and biological activity. Marine Drugs, 6(1): 12–24, doi: 10.3390/md6010012
Dasari V R R K, Muthyala M K K, Nikku M Y, et al. 2012. Novel Pyridinium compound from marine actinomycete, Amycolatopsis alba var. nov. DVR D4 showing antimicrobial and cytotoxic activities in vitro. Microbiological Research, 167(6): 346–351, doi: 10.1016/j.micres.2011.12.003
Doelle H W. 2014. Bacterial Metabolism. Amsterdam: Academic Press, 1-45
Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution, 39(4): 783–791, doi: 10.1111/j.1558-5646.1985.tb00420.x
Fenical W, Jensen P R, Palladino M A, et al. 2009. Discovery and development of the anticancer agent salinosporamide A (NPI-0052). Bioorganic & Medicinal Chemistry, 17(6): 2175–2180
Fu P, Johnson M, Chen H, et al. 2014. Carpatamides A-C, cytotoxic arylamine derivatives from a marine-derived Streptomyces sp. Journal of Natural Products, 77(5): 1245–1248, doi: 10.1021/np500207p
Gontang E A, Gaudêncio S P, Fenical W, et al. 2010. Sequence-based analysis of secondary-metabolite biosynthesis in marine actinobacteria. Applied and Environmental Microbiology, 76(8): 2487–2499, doi: 10.1128/AEM.02852-09
Gozari M, Bahador N, Jassbi A R, et al. 2018. Antioxidant and cytotoxic activities of metabolites produced by a new marine Streptomyces sp. isolated from the sea cucumber Holothuria leucospilota. Iranian Journal of Fisheries Sciences, 17(2): 413–426
Gozari M, Bahador N, Mortazavi M S, et al. 2019a. An “olivomycin A” derivative from a sponge-associated Streptomyces sp. strain SP 85. 3. Biotech, 9: 439
Gozari M, Mortazavi M S, Bahador N, et al. 2016a. Isolation and screening of antibacterial and enzyme producing marine actinobacteria to approach probiotics against some pathogenic vibrios in shrimp Litopenaeus vannamei. Iranian Journal of Fisheries Sciences, 15(1): 630–644
Gozari M, Mortazavi M S, Karim zadeh R, et al. 2016b. Isolation, Identification and Evaluation of antimicrobial activity of Actinomycetes from marine sediments of Persian Gulf (Hormozgan Province). Iranian Scientific Fisheries Journal (in Persian), 25: 81–93
Gozari M, Zaheri A, Jahromi S T, et al. 2019b. Screening and characterization of marine actinomycetes from the northern Oman Sea sediments for cytotoxic and antimicrobial activity. International Microbiology, 22(4): 521–530, doi: 10.1007/s10123-019-00083-3
Hameş-Kocabaş E E, Uzel A. 2012. Isolation strategies of marine-derived actinomycetes from sponge and sediment samples. Journal of Microbiological Methods, 88(3): 342–347, doi: 10.1016/j.mimet.2012.01.010
Istianto Y, Koesomowidodo R S A, Saputra H, et al. 2012. Application of phenol pretreatment for the isolation of rare Actinomycetes from Indonesian soil. Microbiology Indonesia, 6(1): 42–47, doi: 10.5454/mi.6.1.7
Jensen P R, Dwight R, Fenical W. 1991. Distribution of actinomycetes in near-shore tropical marine sediments. Applied and Environmental Microbiology, 57(4): 1102–1108
Jensen P R, Gontang E, Mafnas C, et al. 2005. Culturable marine actinomycete diversity from tropical Pacific Ocean sediments. Environmental Microbiology, 7(7): 1039–1048, doi: 10.1111/j.1462-2920.2005.00785.x
Karamouz M, Nazif S, Falahi M. 2012. Hydrology and Hydroclimatology: Principles and Applications. Boca Raton: CRC Press, 79–84
Karthik L, Kumar G, Rao K V B. 2013. Antioxidant activity of newly discovered lineage of marine actinobacteria. Asian Pacific Journal of Tropical Medicine, 6(4): 325–332, doi: 10.1016/S1995-7645(13)60065-6
Kesavan S S S. 2015. Isolation, characterization and screening for anticancer property of sediment derived actinomycetes from South East coast of India. International Journal of Pharma and Bio Sciences, 6(1): 491–498
Kieser T, Bibb M J, Buttner M J, et al. 2000. Practical Streptomyces Genetics. Norwich, England: John Innes Foundation
Kumar S, Stecher G, Tamura K. 2016. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular Biology and Evolution, 33(7): 1870–1874, doi: 10.1093/molbev/msw054
Kurtböke D İ. 2017. Ecology and habitat distribution of actinobacteria. In: Wink J, Mohammadipanah F, Hamedi J, eds. Biology and Biotechnology of Actinobacteria. Cham: Springer, 123–149
Lee D R, Lee S K, Choi B K, et al. 2014. Antioxidant activity and free radical scavenging activities of Streptomyces sp. strain MJM 10778. Asian Pacific Journal of Tropical Medicine, 7(12): 962–967, doi: 10.1016/S1995-7645(14)60170-X
Leong L P, Shui G. 2002. An investigation of antioxidant capacity of fruits in Singapore markets. Food Chemistry, 76(1): 69–75, doi: 10.1016/S0308-8146(01)00251-5
Madden T. 2013. The BLAST sequence analysis tool. The NCBI Handbook[Internet]. Bethesda, MD: National Library of Medicine (US), National Center for Biotechnology Information
Mahmoud H M, Kalendar A A. 2016. Coral-associated Actinobacteria: diversity, abundance, and biotechnological potentials. Frontiers in Microbiology, 7: 204
Maldonado L A, Fragoso-Yáñez D, Pérez-García A, et al. 2009. Actinobacterial diversity from marine sediments collected in Mexico. Antonie van Leeuwenhoek, 95(2): 111–120, doi: 10.1007/s10482-008-9294-3
Manivasagan P, Venkatesan J, Sivakumar K, et al. 2014. Pharmaceutically active secondary metabolites of marine actinobacteria. Microbiological Research, 169(4): 262–278, doi: 10.1016/j.micres.2013.07.014
Mann K H, Lazier J R. 2013. Dynamics of Marine Ecosystems: Biological-Physical Interactions in the Oceans. Oxford: John Wiley & Sons, 7–67
Meyer B N, Ferrigni N R, Putnam J E, et al. 1982. Brine shrimp: a convenient general bioassay for active plant constituents. Planta Medica, 45(5): 31–34, doi: 10.1055/s-2007-971236
Mincer T J, Fenical W, Jensen P R. 2005. Culture-dependent and culture-independent diversity within the obligate marine actinomycete genus Salinispora. Applied and Environmental Microbiology, 71(11): 7019–7028, doi: 10.1128/AEM.71.11.7019-7028.2005
Olano C, Méndez C, Salas J A. 2009. Antitumor compounds from marine actinomycetes. Marine Drugs, 7(2): 210–248, doi: 10.3390/md7020210
Orr H A. 2005. The genetic theory of adaptation: a brief history. Nature Reviews Genetics, 6(2): 119–127, doi: 10.1038/nrg1523
Palaniappan S, Panchanathan M, Packiyaraj V, et al. 2013. Antibacterial and brine shrimp lethality effect of marine actinobacterium Streptomyces sp. CAS72 against human pathogenic bacteria. Asian Pacific Journal of Tropical Disease, 3(4): 286–293, doi: 10.1016/S2222-1808(13)60071-7
Qiu D H, Ruan J S, Huang Y. 2008. Selective isolation and rapid identification of members of the genus Micromonospora. Applied and Environmental Microbiology, 74(17): 5593–5597, doi: 10.1128/AEM.00303-08
Saitou N, Nei M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, 4(4): 406–425
Seidel V. 2006. Initial and bulk extraction. In: Sarker S D, Latif Z, Gray A I, eds. Natural Products Isolation. New Jersey: Humana Press, 27–46
Ser H L, Palanisamy U D, Yin W F, et al. 2016. Streptomyces malaysiense sp. nov.: a novel Malaysian mangrove soil actinobacterium with antioxidative activity and cytotoxic potential against human cancer cell lines. Scientific Reports, 6: 24247, doi: 10.1038/srep24247
Ser H L, Tan LT H, Law JW F, et al. 2017. Focused review: cytotoxic and antioxidant potentials of mangrove-derived Streptomyces. Frontiers in Microbiology, 8: 2065, doi: 10.3389/fmicb.2017.02065
Solan M, Whiteley N. 2016. Stressors in the Marine Environment: Physiological and Ecological Responses; Societal Implications. Oxford: Oxford University Press, 70–91
Whitman W, Goodfellow M, Kämpfer P, et al. 2012. Bergey’s Manual® of Systematic Bacteriology: Volume Five. The Actinobacteria, Part A. 2nd ed. New York: Springer
Zotchev S B, Sekurova O N, Kurtböke D İ. 2017. Metagenomics of marine actinomycetes: from functional gene diversity to biodiscovery. In: Kim S K, ed. Marine OMICS: Principles and Applications. Boca Raton: CRC Press, 165–186
Year 2019 volume 38 Issue 12
PDF
170
102
Cite this Article
BibTeX
Article Info
doi: 10.1007/s13131-019-1515-2
  • Receive Date:2018-12-17
  • Online Date:2026-04-01
  • Published:2019-12-25
Article Data
Affiliations
History
  • Received:2018-12-17
  • Accepted:2019-03-28
Affiliations
    1 Department of Microbiology, College of Science, Agriculture and Modern Technology, Shiraz Branch, Islamic Azad University, Shiraz 71331, Iran
    2 Persian Gulf and Oman Sea Ecological Research Center, Iranian Fisheries Science Research Institute (IFSRI), Agricultural Research, Education and Extension Organization (AREEO), Bandar Abbas 79131, Iran
    3 Medicinal and Natural Products Chemistry Research Center, Shiraz University of Medical Sciences, Shiraz 71331, Iran
    4 Iranian National Institute of Oceanography and Atmospheric Science, Tehran 1414, Iran
    5 Molecular Medicine Research Center, Hormozgan Health Institute, Hormozgan University of Medical Sciences, Bandar Abbas 79131, Iran

Corresponding:

References
Share
https://castjournals.cast.org.cn/joweb/aos/EN/10.1007/s13131-019-1515-2
Share to
QR

Scan QR to access full text

Cite this article
BibTeX
Citations
表12种不同金属材料的力学参数

Family
属数
Number of
genus
种数
Number of
species
占总种数比例
Percentage of
total species (%)

Genus
种数
Number of
species
占总种数比例
Percentage of total
species (%)
鹅膏菌科Amanitaceae 2 11 5.26 鹅膏菌属 Amanita 10 4.78
小菇科 Mycenaceae 2 12 5.74 丝盖伞属 Inocybe 5 2.39
多孔菌科 Polyporaceae 8 14 6.70 蜡蘑属 Laccaria 5 2.39
红菇科 Russulaceae 3 23 11.00 小皮伞属 Marasmius 6 2.87
小菇属 Mycena 11 5.26
光柄菇属 Pluteus 5 2.39
红菇属 Russula 17 8.13
栓菌属 Trametes 5 2.39
关闭全屏
  • BibTeX
  • EndNote
  • RefWorks
  • TxT