收藏切换
Phenotypic plasticity and taxonomy of Cladophora gracilis (Griffiths) Kützing (Cladophorales, Chlorophyta) in the western Yellow Sea with the implication of its DNA barcode
收藏切换
PDF
Bingxin Huang1, 2, 3, Linhong Teng2, Jingjing Jiang1, 3, Lanping Ding1, 2, 3, *
Acta Oceanologica Sinica | 2020, 39(10) : 162 - 170
Less
收藏切换
Acta Oceanologica Sinica | 2020, 39(10): 162-170
Marine Biology
Phenotypic plasticity and taxonomy of Cladophora gracilis (Griffiths) Kützing (Cladophorales, Chlorophyta) in the western Yellow Sea with the implication of its DNA barcode
Full
Bingxin Huang1, 2, 3, Linhong Teng2, Jingjing Jiang1, 3, Lanping Ding1, 2, 3, *
Affiliations
  • 1 Collage of Life Sciences, Tianjin Normal University, Tianjin 300387, China
  • 2 Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China
  • 3 Tianjin Key Laboratory of Animal and Plant Resistance, Tianjin 300387, China
Published: 2020-10-25 doi: 10.1007/s13131-020-1586-0
Outline
收藏切换

Due to extensive morphological plasticity, the taxonomy of Cladophora species remains unclear. As one of the widely distributed species, C. gracilis was reported to hold many varieties, which make it difficult to identify the species. This study explored the morphology diversity of nine C. gracilis samples collected along the coast of western Yellow Sea. Some samples showed extremely varied characteristics, by which one cannot classify them correctly. Hence, 18S rDNA and nuclear ribosomal DNA internal transcribed spacer regions (ITS) sequences were employed to delimit species. For 18S rDNA, sequence similarity ranged from 99.6% to 100%. For ITS region, the similarity ranged from 98.7% to 100%. Molecular data strongly suggested that the morphologically heterogeneous samples were actually the same species. Characteristics comparison of the samples revealed that the taxonomy criteria including branching pattern and density, thallus color, height and texture varied widely, influenced by environmental conditions and age of alga. Besides, cell dimensions, as the relatively stable criterion, also exhibited intraspecific variance. Successful application of 18S rDNA and ITS sequences indicated that molecular method can be a powerful assistant as DNA barcodes to traditional morphology taxonomy.

Cladophora gracilis  /  morphology observation  /  molecular identification  /  18S rDNA  /  ITS
Bingxin Huang, Linhong Teng, Jingjing Jiang, Lanping Ding. Phenotypic plasticity and taxonomy of Cladophora gracilis (Griffiths) Kützing (Cladophorales, Chlorophyta) in the western Yellow Sea with the implication of its DNA barcode[J]. Acta Oceanologica Sinica, 2020 , 39 (10) : 162 -170 . DOI: 10.1007/s13131-020-1586-0
Cladophora Kützing (1843) is one of the largest green-algal genera and has a worldwide distribution. Within the family Cladophoraceae, the genus Cladophora is characterized by its simple thallus architecture with branched, uniseriate filaments of multinucleate cells. It is a heterogeneous and confusing assemblage of species with varied appearances. Because most morphological characteristics used to define species, such as branching pattern, color, cell dimensions, overlap among described species, vary with age and environment, taxonomic identification within the genus has challenged phycologists for decades (van den Hoek, 1963, 1982; Söderström, 1963, 1965; Dodds and Gudder, 1992). More than 600 species have been attributed to the genus over the past 200 years. While more than 400 species were turned out to be synonymous ones (van den Hoek, 1963, 1982; van den Hoek C and Chihara, 2000). At the present, there are only 196 species accepted taxonomically (Guiry, 2018).
Cladophora gracilis was first reported by Griffiths ex Harvey (1834) as Conferva gracilis, and then transferred to Cladophora by Kützing (1845). This species was widely distributed around the world (Adams, 1907; Taylor, 1957, 1960; Yoshida, 1998; Lee and Kang, 2001). Van den Hoek (1963) listed it as a synonym of C. sericea. For seaweed classification, a number of characteristics such as thallus height, color and cell size are dependent on plant maturity and environmental conditions (Mathieson et al., 1981). Due to various morphology characteristics, C. gracilis had been reported many varieties (Taylor, 1957). Hence, in nature, the extensive morphology plasticity makes it problematic to delineate the species. With the development of DNA sequencing, the difficulty of morphological taxonomy motivated our use of molecular techniques to assist classification. 18S rDNA and nuclear ribosomal DNA internal transcribed spacer regions (ITS1 and ITS2) had been employed in a range of phycological studies (Bakker et al., 1992, 1994; Zechman et al., 1994; Goff et al., 1994). In present study, we aimed to clarify the extremely extensive phenotypic plasticity of C. gracilis based on molecular analysis, and tried to explore the availability of it DNA barcode.
The samples were collected by the author from different localities along the coast of western Yellow Sea at different months. Detailed information was listed in Table 1. The collected samples were processed as herbarium specimens on the same day. Others were preserved at –20°C for DNA extraction and morphological identification.
Living samples were observed as far as possible. The morphological characteristics including thallus color, height, texture, branching pattern were observed. Cell diameter, cell length and ratio of cell length to diameter of main axes, branches and apical cells of ultimate branches were measured under light microscope (ZEISS Axioskop2). Micrographs were taken with digital camera (ZEISS Axiocam MRc5).
Total DNA was extracted from isolated nine samples using TianGen Plant Genomic DNA Kit. Primers were designed according to the conserved region in 18S rDNA and 28S rDNA and synthesized by Nanjing Genscript Corporation as the following sequences:
$\begin{array}{lll} \text { 18S rDNA } & \mathrm{F} & 5^{\prime} \text { AATGGCTCGGTAAATCAGTT 3' } \\ & \mathrm{R} & 5^{\prime} \text { AGTTGATGACTCGCGCTTAC 3' } \\ & \mathrm{F} & 5^{\prime} \text { GGAAGGAGAAGTCGTAACAAGG 3' } \\ \text { ITS } & \mathrm{R} & 5^{\prime} \text { ATTCCCAAACAACCCGACTC 3' } \end{array}$
The reaction mixture used for PCR contained 25 μL PCR Mix Kit (Dongsheng Corp.), 5 μL DNA template, 0.5 μL Taq DNA polymerase (5 U/μL), 0.5 μL of each primer (50 μmol/L), and ddH2O was added to a final volume of 50 μL. PCR was performed in PCR instrument (TaKaRa). The cycle was 2 min initial denaturing at 94°C, followed by 30 s at 94°C, 1 min at 55°C and 1 min at 72°C for 30 cycles, and a final extension at 72°C for 10 min. To estimate the size of the amplified fragment, the product was run on a 1% agarose gel, stained with ethidium bromide solution, visualized under UV light, and photographed. The product was purified and sequenced by Shanghai Sunny Biotechnology Corp.
18S rDNA and ITS sequences of nine samples were aligned and the pairwise distance was calculated using MEGA4 (Tamura et al., 2007) with Kimura’s 2-parameter model (Kimura, 1980). Sequences similarity was calculated using Bioedit (Hall, 1999). The related sequences acquired by BLAST were downloaded from Genbank and complete alignments were conducted using Clustal X (Thompson et al., 1997), maximum parsimony (MP) method was used to construct phylogenetic tree using PAUP4.0b10 (Swofford, 2002). Gaps were treated as missing data. All sites were treated as unordered and equally weighted. Heuristic search option with random addition of sequences (10 replicates) and tree-bisection-reconnection (TBR) were used for tree searching. A total of 1000 bootstrap replications were performed using heuristic searches. Anadyomenaceae species were used as outgroup.
Cladophora gracilis (Griffiths) Kützing 1845: 215; 1849: 403 (Kützing, 1845, 1849); Harvey 1849: 202 (Harvey, 1849); Kjellman 1883: 308 (Kjellman, 1883); Foslie 1890: 316 (Foslie, 1890); Setchell et Gardner 1920: 216 (Setchell and Gardner, 1920); Hamel 1928: 21, Fig. 16A (Hamel, 1928); Okamura 1936: 58, Fig. 28 (Okamura, 1936); Taylor 1957: 86, pl. 5, Fig. 2, pl. 6, Figs 3 and 4 (Taylor, 1957); Sakai 1964: 33, Fig. 12, pl. 6, Fig. 1 (Sakai, 1964); Luan 1989: 114, Fig. 149 (Luan, 1989); Yoshida 1998: 63 (Yoshida, 1998).
Conferva gracilis Griffiths in Harvey 1834: 304, nom.illeg (Harvey, 1834).
The thalli are 2–20 cm high with light to dark green in color, soft to rigid in texture and flaccid to stiff erect filaments. The main axes are pseudodichotomously branching with 1–5 branches per cell, present or not. The branches are alternate or uni-lateral or opposite or verticillate with curved or second branchlets. The cell dimensions among main axis, branch and ultimate branch are 50–270 μm, 40–190 μm and 20–110 μm with length/width 2–10, 1–9 and 2–11, respectively.
The observed morphological characteristics to the samples were photographed and summarized in details in Fig. 1 and Table 2.
18S rDNA and ITS sequences of the nine samples have been submitted to Genbank (JN574840–JN574857). We compared the sequence of samples and then aligned them with related sequences from the Genbank (Table 3). For 18S rDNA, a total of 892 characters were included in the analysis, of which 42 were parsimony-informative. The conserved 18S rDNA showed low divergence. The sequences similarity among the specimens ranged from 99.6%–100%, with only several different characters. The complete ITS1-5.8S rDNA-ITS2 sequences were defined based on the homology with other sequences identified in a BLAST search of the Genbank database (Table 4). The length of ITS1 was 385–391 bp. The length of ITS2 was 308–316 bp. The length of 5.8S rDNA was 157 bp for all samples. The ITS sequences similarity ranged from 98.7%–100%.
Phylogenetic trees constructed with MP methods were shown in Figs 2 and 3. In both the two trees, the nine samples clustered together and then grouped with other species, indicating the conspecific results of the samples.
As a heterogeneous assembles of species, the taxonomy of Cladophora is always problematic. Our morphological observation and molecular classification strongly revealed the widely intraspecific plasticity, and prompted us to reconsider the reliability of the taxonomy criteria.
One of the most valuable taxonomic criteria in genus Cladophora is its branching system. While the nine samples of C. gracilis showed highly variable branching system, making it difficult to classify. Some specimens including AST2010015 and AST2010028 are characterized by a distinctly sparse ramification, the thalli being reduced to main axes. These old plants’ reduced branching system interfered with the accurate taxonomy, and then molecular assistance was resorted. Additionally, specimen AST2010027 may be confused with C. catenata due to the sparse, irregular and wide-angled branches as well as the small plants (2–5 cm) (Figs 1p-q). This specimen was collected at sea beach, exposed to fierce wave action. The small plants entangled together and floated with seawater, under which circumstance they developed into irregular branches. While they can be distinguished from each other by cell size, with cell diameter 200–500 μm of C. catenata, obviously larger than that of C. gracilis. Branching pattern can also be variable. Branches from main axes were fastigiated, verticillate for AST2010017, alternate for AST2009001, AST2010004 and AST2010005, opposite for AST2010015 and AST2010028. For most samples, the ultimate branches were secund, such as AST2009001, AST2010004, AST2010005, AST2010010 and AST2010029. Besides, ultimate branch systems were often more or less incurved or recurved, such as AST2009001. Generally, most specimens had 1–3 branches per node, with the exception of sample AST2010017. There were up to 5 branches per node, forming fasciculate terminal branch-systems, which belonged to the feature of C. fascicularis. This kind of interspecific overlapped characteristics usually leads to incorrect taxonomy result. From what has been discussed above, it can be drown that branching system may vary widely among intraspecific populations and should not be considered as stable taxonomic criterion.
Thallus color as well as height was directly visible traits of plants, while both of which were also highly variable. Among the surveyed samples, thallus color varied from dark green to light green. Especially, for AST2010010, there is obviously distinct color within the same individual. Part of the plant grew at shaded localities, its robust filaments showing dark green habit. While for other parts exposed to direct sunlight, its relatively thin filaments exhibited light green (Figs 1i-k). This conspicuous contrast weakened the reliability of thallus color as taxonomic character. Besides, the height of full grown plants was variable too, ranging from 5 cm to 20 cm. Likewise, this character was influenced by environmental conditions. Exposure to wave action promoted the formation of short, compact tufts (van den Hoek, 1982). Thus, as stated above, the sample AST2010027 formed short, spherical tufts. For most other samples attaching at rigid rocks of sheltered water pools, such as AST2010004, AST2010005 and AST2010029, filaments length can reached to 20 cm. We can conclude from above that thallus habits including color and height exist extensive intraspecific plasticity for C. gracilis, and care must be taken when these characteristics are used for distinction of the species.
As one of the most important characteristics, diameter of main axes, branches and ultimate branches are also highly variable. Of course, the distinction between slender species, such as C. flexuosa and very robust species such as C. catenata is obvious, but the existence of a series of samples with intermediate sizes makes the use of this characteristic problematic (Table 2). For the reported C. gracilis, the diameter of main axes is 100–140 μm, that of branches is 70–125 μm, and that of ultimate branches is 50–75 μm (Ding and Luan, 2013). Yet from Table 2, we can see that not all the samples corresponded to that criterion. Obviously, delineating species is difficult because most easily observed morphological traits are highly variable. This extensive phenotypic variety makes molecular approach play a significant role in classification. Analysis of both the conserved 18S rDNA and fast-evolving ITS sequences demonstrated that the nine samples belonged to the same evolution entity. They can be applied as DNA barcode for accurate anchoring this species.
It is clear that there is extensive intraspecific heterogeneity in traditional measured morphological traits, making it difficult to develop a reliable method of distinguishing species. In view of the difficulty in morphology taxonomy of Cladophora, molecular data has potential feasibility assisting traditional classification methodology.
We are grateful to Saren Gaowa, Wei Zhang, Tao Wang, Chunmei Bao for their kind laboratory technical assistance, and the members of marine biological museum of IOCAS for their help.
  • The National Natural Science Foundation of China under contract Nos 31670199, 31400186 and 30499340; the Knowledge Innovation Project of Chinese Academy of Sciences under contract No. KSCX2-YW -Z-018; the Scientific Research Plan of Tianjin Municipal Education Committee under contract No. JW1705; the Research Fund for Talented Scholars of Tianjin Normal University (2016).
Adams J. 1907. The seaweeds of the Antrim coast [dissertation]. Ulster: Ulster Fisheries and Biological Association, 29–37
Bakker F T, Olsen J L, Stam W T, et al. 1992. Nuclear ribosomal DNA internal transcribed spacer regions (ITS1 and ITS2) define discrete biogeographic groups in Cladophora albida (Chlorophyta). Journal of Phycology, 28(6): 839–845, doi: 10.1111/j.0022-3646.1992.00839.x
Bakker F T, Olsen J L, Stam W T, et al. 1994. The Cladophora complex (Chlorophyta): new views based on 18S rRNA gene sequences. Molecular Phylogenetics and Evolution, 3(4): 365–382, doi: 10.1006/mpev.1994.1043
Ding Lanping, Luan Rixiao. 2013. Flora Algarum Marinarum (in Chinese). Beijing: Science Press
Dodds W K, Gudder D A. 1992. The ecology of Cladophora. Journal of Phycology, 28(4): 415–427, doi: 10.1111/j.0022-3646.1992.00415.x
Foslie M H. 1890. Contribution to knowledge of the marine algae of Norway: I. East-Finmarken. Tromsø Museums Aarshefter B, 13: 1–186
Goff L J, Moon D A, Coleman A W. 1994. Molecular delineation of species and species relationships in the red algal agarophytes Gracilariopsis and Gracilaria (Gracilariales). Journal of Phycology, 30(3): 521–537, doi: 10.1111/j.0022-3646.1994.00521.x
Guiry M D. 2018. AlgaeBase. World-wide electronic publication, National University of Ireland, Galway. http://www.algaebase.org [2018–11–08]
Hall T A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41: 95–98
Hamel G. 1928. La répartition des algues à Saint-Malo et dans la Rance. Travaux du Laboratoire maritime du Muséum national d’Histoire naturelle à l’Arsenal de Saint-Servan, 3: 1–27
Harvey W H. 1834. Algological illustrations. No. I. Remarks on some British algae, and descriptions of new species recently added to our flora. Journal of Botany [Hooker], 1: 296–305
Harvey W H. 1849. A Manual of the British Marine Algae: Containing Generic and Specific Descriptions of All the Known British Species of Sea-Weeds. London: John Van Voorst, 1–252
Kimura M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution, 16(2): 111–120, doi: 10.1007/BF01731581
Kjellman F R. 1883. Norra Ishafvets algflora. Vega-expeditionens Vetenskapliga Arbeten, 3: 1–431
Kützing F T. 1843. Phycologia generalis oder Anatomie, Physiologie und Systemkunde der Tange. Mit 80 farbig gedruckten Tafeln, gezeichnet und gravirt vom Verfasser. Leipzig: F A Brockhaus, 143–458
Kützing F T. 1845. Phycologia germanica, d.i. Deutschlands Algen in bündigen Beschreibungen. Nebst einer Anleitung zum Untersuchen und Bestimmen dieser Gewächse für Anfänger. Nordhausen: W. Köhne, 1–340
Kützing F T. 1849. Species Algarum. Lipsiae: F A Brockhaus
Lee Y, Kang S. 2001. A Catalogue of the Seaweeds in Korea. Jeju: Cheju National University Press, 8, 1–662
Luan Rixiao. 1989. Field Guide of Marine Algae Along Dalian Coast (in Chinese). Dalian: Dalian Maritime University Press, 1–129
Mathieson A C, Norton T A, Neushul M. 1981. The taxonomic implications of genetic and environmentally induced variations in seaweed morphology. The Botanical Review, 47(3): 313–347, doi: 10.1007/BF02860577
Okamura K. 1936. Nippon Kaisô Shi [Descriptions of Japanese algae]. Tokyo: Uchidarokakuho, 1–964
Sakai Y. 1964. The species of Cladophora from Japan and its vicinity. Scientific Papers of the Institute of Algological Research, Faculty of Science, Hokkaido University, 5(1): 1–104
Setchell W A, Gardner N L. 1920. The Marine Algae of the Pacific Coast of North America. Part Ⅱ. Chlorophyceae. California: University of California Publications in Botany, 8: 139–374
Söderström J. 1963. Studies in Cladophora. Botanica Gothoburgensia, 1: 1–147
Söderström J. 1965. Remarks on some species of Cladophora in the sense of van den Hoek and of Söderström. Botanica Marina, 8(1–2): 169–182
Swofford D L. 2002. PAUP: Phylogenetic Analysis Using Parsimony (and Other Methods). Sunderland, Massachusetts: Sinauer Associates
Tamura K, Dudley J, Nei M, et al. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution, 24(8): 1596–1599, doi: 10.1093/molbev/msm092
Taylor W R. 1957. Marine Algae of the Northeastern Coast of North America. Ann Arbor: The University of Michigan Press
Taylor W R. 1960. Marine Algae of the Eastern Tropical and Subtropical Coasts of the Americas. Ann Arbor: Ann Arbor the University of Michigan Press, 1–870
Thompson J D, Gibson T J, Plewniak F, et al. 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research, 25(24): 4876–4882, doi: 10.1093/nar/25.24.4876
van den Hoek C. 1963. Revision of the European species of Cladophora. Leiden: Brill E J, 1–248
van den Hoek C. 1982. A Taxonomic Revision of the American Species of Cladophora (Chlorophyceae) in the North Atlantic Ocean and Their Geographic Distribution. Amsterdam: North Holland Publishing
van den Hoek C, Chihara M. 2000. A Taxonomic Revision of the Marine Species of Cladophora (Chlorophyta) Along the Coasts of Japan and the Russion Far-East. Tokyo: Natural Science Museum
Yoshida T. 1998. Marine Algae of Japan. Tokyo: Uchida Rokakuho Publishing Co, Ltd, 1–2, 1–25, 1–1222
Zechman F W, Zimmer E A, Theriot E C. 1994. Use of ribosomal DNA internal transcribed spacers for phylogenetic studies in diatoms. Journal of Phycology, 30(3): 507–512, doi: 10.1111/j.0022-3646.1994.00507.x
Year 2020 volume 39 Issue 10
PDF
252
142
Cite this Article
BibTeX
Article Info
doi: 10.1007/s13131-020-1586-0
  • Receive Date:2019-04-18
  • Online Date:2026-03-31
  • Published:2020-10-25
Article Data
Affiliations
History
  • Received:2019-04-18
  • Accepted:2019-09-20
Funding
The National Natural Science Foundation of China under contract Nos 31670199, 31400186 and 30499340; the Knowledge Innovation Project of Chinese Academy of Sciences under contract No. KSCX2-YW -Z-018; the Scientific Research Plan of Tianjin Municipal Education Committee under contract No. JW1705; the Research Fund for Talented Scholars of Tianjin Normal University (2016).
Affiliations
    1 Collage of Life Sciences, Tianjin Normal University, Tianjin 300387, China
    2 Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China
    3 Tianjin Key Laboratory of Animal and Plant Resistance, Tianjin 300387, China

Corresponding:

References
Share
https://castjournals.cast.org.cn/joweb/aos/EN/10.1007/s13131-020-1586-0
Share to
QR

Scan QR to access full text

Cite this article
BibTeX
Citations
表12种不同金属材料的力学参数

Family
属数
Number of
genus
种数
Number of
species
占总种数比例
Percentage of
total species (%)

Genus
种数
Number of
species
占总种数比例
Percentage of total
species (%)
鹅膏菌科Amanitaceae 2 11 5.26 鹅膏菌属 Amanita 10 4.78
小菇科 Mycenaceae 2 12 5.74 丝盖伞属 Inocybe 5 2.39
多孔菌科 Polyporaceae 8 14 6.70 蜡蘑属 Laccaria 5 2.39
红菇科 Russulaceae 3 23 11.00 小皮伞属 Marasmius 6 2.87
小菇属 Mycena 11 5.26
光柄菇属 Pluteus 5 2.39
红菇属 Russula 17 8.13
栓菌属 Trametes 5 2.39
关闭全屏
  • BibTeX
  • EndNote
  • RefWorks
  • TxT