收藏切换
Characterization of some bacterial strains isolated from the Egyptian eastern and northern coastlines with antimicrobial activity of Bacillus zhangzhouensis OMER4
收藏切换
PDF
Mohamed O. Soliman1, Waleed B. Suleiman1, *, Mohamed M. Roushdy1, Eman N. Elbatrawy2, Ahmed M. Gad3
Acta Oceanologica Sinica | 2022, 41(3) : 86 - 93
Less
收藏切换
Acta Oceanologica Sinica | 2022, 41(3): 86-93
Marine Biology
Characterization of some bacterial strains isolated from the Egyptian eastern and northern coastlines with antimicrobial activity of Bacillus zhangzhouensis OMER4
Full
Mohamed O. Soliman1, Waleed B. Suleiman1, *, Mohamed M. Roushdy1, Eman N. Elbatrawy2, Ahmed M. Gad3
Affiliations
  • 1 Department of Botany and Microbiology, Faculty of Science, Al-Azhar University, Cairo 11884, Egypt
  • 2 The Regional Center for Mycology and Biotechnology, Al-Azhar University, Cairo 11884, Egypt
  • 3 Microbiology Laboratory, Marine Environmental Division, National Institute of Oceanography and Fisheries, Alexandria 11865, Egypt
Published: 2022-03-25 doi: 10.1007/s13131-021-1926-8
Outline
收藏切换

Marine microorganisms were considered to be important sources of marine bioactive compounds. The major objective of the study was to isolate and characterize bacteria with antimicrobial activities from the various marine environment of Egypt. In this respect, thirty-five bacterial isolates were recovered from sediment samples collected from different spots along the Egyptian Red Sea coastline and Alexandria coastline during the summer season of 2017 and 2018. According to the morphological, physiological, and biochemical characteristics, the bacterial isolates were clustered into 13 groups designated as A, B, ···, M. And, 14 Gram-negative and 21 Gram-positive bacteria were determined. The isolated bacterial strains were screened for their potentiality for antimicrobial agent(s) production against ten indicator strains. Strain Mo13 was showed high antimicrobial activity against all empirical strains. Subsequently, the most promising marine bacterial isolate with code MO13 was identified as Bacillus zhangzhouensis OMER4 according to the phenotypic characterization through morphological, physiological, and biochemical tests as well as genotypic characterization through the 16S rDNA technique. The bioactive components were extracted with ethyl acetate, then analyzed using GC-MS and the substantial component was recognized as phenol, 2, 4-bis(1, 1-dimethyl ethyl).

marine bacteria  /  natural product  /  Egyptian coastline  /  antimicrobial  /  Bacillus zhangzhouensis  /  GC-MS characterization
Mohamed O. Soliman, Waleed B. Suleiman, Mohamed M. Roushdy, Eman N. Elbatrawy, Ahmed M. Gad. Characterization of some bacterial strains isolated from the Egyptian eastern and northern coastlines with antimicrobial activity of Bacillus zhangzhouensis OMER4[J]. Acta Oceanologica Sinica, 2022 , 41 (3) : 86 -93 . DOI: 10.1007/s13131-021-1926-8
The bacterial world is full of spectacular impact on the environment as a component of the ecosystem which deal with many functions whether harmful or beneficial some of the beneficial impacts is bioremediation, biosynthesis of natural products, and so on (Abdel-Razek et al., 2020). For more than seven decades, bacteria have been considered a bio-active source of natural products, some of which were developed into medicines to treat infections and other diseases (Sekurova et al., 2019). Currently, about 60% of confirmed small-molecule drugs are associated with natural products, also about 69% of all antibacterial compounds are extracted from natural products (Patridge et al., 2016; Suleiman, 2020). Microorganisms are considered as sources of valuable compounds such as PUFAs and lipids from oleaginous fungi (Hashem et al., 2020a, b, 2021) which could contribute in the field of sustainable development to help in biodiesel production. Natural products, especially antibiotics, have played an important role in drug exploration in the last several decades and have extended the process of developing medicines with a high level of therapeutic effect (Dias et al., 2012). However, widespread resistance was resulted because of the indiscriminate, prolonged, and wide use of antibiotics without physician description (Suleiman, 2017).
Terrestrial sources have previously been widely researched for the detection of new bioactive compounds (Ullah et al., 2019). However, nowadays, the detection of new sources of antimicrobial and other biologically active compounds from the marine habitat is growing increasingly although it is still under research (López et al., 2018). Marine microorganisms are rich sources of natural products with promising biological activities, especially bacteria and fungi (Barzkar et al., 2019). These microorganisms, particularly those of deep-sea origin, are thought to possess higher potential than terrestrial microorganisms for the production of various secondary metabolites with different bioactivities (Skropeta and Wei, 2014). Adaptations to severe environmental conditions such as low or high temperature, high salinity, high pressure, etc. might contribute to the development of structurally novel and biologically essential compounds by marine microorganisms (Manivasagan et al., 2013).
The current study was based on three main goals. Firstly, the examination of antimicrobial activity by marine bacteria isolated from sediment samples. Secondly, producing an antimicrobial agent(s) by marine samples isolated from the Egyptian eastern and northern coastlines. Thirdly, the bioactive compounds produced by marine origin extracts were performed using GC-MS for mass spectroscopic characterization.
Isolation of marine bacteria from the sediment samples of the Red Sea and Mediterranean Sea (Alexandria, Egypt) (Table 1) was carried out by the spread plate method and serial dilution. One gram of collected samples was serially diluted in sterilized seawater to get a population range from 10−1 to 10−6. Each dilution (1 mL) was platted out on marine nutrient agar plates that were incubated at 30°C for 48 h, and then counting aerobic bacteria. Colonies were collected depending on the morphological variations and Gram reaction among them, numbered and cultured on slants for further work. The bacterial isolates were further sub-cultured on nutrient agar (NA) medium in order to obtain pure cultures. For more studies, all pure isolates were maintained on slants at 4°C in the refrigerator for further studies.
The similarity matrix was constructed based on the positive or negative of phenotypic characteristics (such as Gram staining, motility, cultural characteristics), physiological characteristics (such as temperature, pH tolerance range, and salinity tolerance range) and biochemical characteristics (such as catalase, oxidase, and IMViC test) for each isolate which was scored as 1 and 0, respectively. The data were analyzed and a dendrogram of cluster analysis was obtained using PRIMER v5.5 software (Rohlf, 1987).
All marine bacterial isolates were tested for their ability to exhibit antimicrobial activities against three Gram-positive bacteria (Enterococcus faecalis ATCC 29212, Bacillus subtilis ATCC 6633, and Staphylococcus aureus ATCC 25923) and four Gram-negative bacteria (Salmonella typhi ATCC 14028, Escherichia coli ATCC 8739, Pseudomonas aeruginosa ATCC 9027, and Vibrio cholerae ATCC 14033). The antifungal screening was carried out against (Candida albicans ATCC 10231, Aspergillus terreus ATCC 10690, and Fusarium solani ATCC 36031). These pathogens were kindly provided by microbiology lab and marine microbiology lab collections at the National Institute of Oceanography and Fisheries (NIOF), Egypt.
The antagonistic activity of the marine bacterial cell-free supernatants was tested by a well-cut diffusion technique (Gad et al., 2016). Nutrient agar plates were swabbed with 100 µL of each strain of pathogenic bacteria using a sterile cotton swab. Approximately 5 mm diameter of the well was made with the help of a sterile gel puncture. Cell-free supernatants (50 µL) were loaded on well then, the plates were incubated at 30°C for 24 h. Antibacterial activity was expressed as the diameter (mm) of the inhibition zone (Amer and Ibrahim, 2019). The diameters of the inhibition zones produced by the supernatant were then compared with the standard antibiotic ciprofloxacin (5 µg/disc) used as positive control and dimethyl sulfoxide (DMSO) used as a negative control by displaying no inhibition zone.
By the same technique, the antifungal activity was performed against the three pathogenic fungi. Subsequently, the plates were incubated at 30°C for 48 h for Candida albicans whilst, 72 h or more in case of filamentous fungi. The activity was determined through the use of amphotericin B (100 units/disc) as a positive guide and DMSO used as a negative control by displaying no inhibition zone.
Phenotypic characteristics such as Gram staining, motility, cultural characteristics, catalase, oxidase, and IMViC test were determined for all the marine bacterial isolates according to the standard methods. The effect of sodium chloride, pH level, and temperature on growth was also tested (Al-Allaf, 2011). Cell morphology was microscopically examined using electron microscope model JEOL-JSM 5300 at electron microscope unit of central laboratory of NIOF (El-Naggar et al., 2006).
DNA of the promising bacterial isolates was extracted and purified using the genomic DNA extraction protocol of Gene JETTM genomic DNA purification Kit (Fermentas). The region of 16S rDNA was enlarged using Maxima Hot Start polymerase chain reaction (PCR) Master Mix (Fermentas) and cleaned using Gene JETTM PCR Purification Kit (Fermentas) using the protocol of Sigma Scientific Services Co., Egypt. The sequencing of the PCR product was performed by GATC Company using ABI 3730xl DNA sequencer by using the 16S DNA universal primer (27F: AGAGTTTGATCCTGGCTCAG and 1492R: GGTTACCTTGTTACGACTT).
Various solvents with different polarities (ethyl acetate, chloroform, n-hexane (95%), and n-butanol) were roughly selected for extracting the antimicrobial agents. One hundred milliliter of different organic solvents were added to 100 mL filtrated fermented broth in a 500 mL separating funnel. The mixture was shaken for 20 min and kept to separate the solvent from the aqueous phase. The organic phase was collected and evaporated, and then dissolved in an appropriate solvent. Antimicrobial activity was determined each time using the well-cut diffusion technique.
The active extract was analyzed by using GC-MS (Suleiman et al., 2019; Elkhateeb et al., 2020). Preliminary identification of components was described using Wiley mass spectral database library according to the results of Hassan et al. (2016).
The Mediterranean Sea is one of the world’s biodiversity hotspots due to its high qualitative resources, in addition to a significant ratio of endemics (Lejeusne et al., 2010), as well as the Red Sea serves as a unique resource of biological diversity by exporting organisms and genetic lines for global aquatic biodiversity systems (Bowen et al., 2013; DiBattista et al., 2013). During the last five years, the majority of the recorded marine species were obtained from the coasts of Egypt, accounting for 58% compared with many other sites on the Red Sea coasts. This may be due to the high biodiversity of species in the Egyptian environment (El-Hossary et al., 2020).
In our study, colony counts of the samples varied between 425 CFU/gm (ie., colony-forming units/granulocyte macrophage) and 2.7 × 106 CFU/gm of sediment. Eastern Harbor sediment harbored the highest average count (2.7 × 106 CFU/gm) followed by Abuqir (8.8 × 105 CFU/gm) and the lowest in Marsa Alam Station (425 CFU/gm). Sediments harbored more bacteria because of the richness in nutrients (Rédou et al., 2015). Eastern Harbor Station harbored more counts than the other stations, suggesting that it may be more polluted. These results are closed to what was observed by El-Bestawy et al. (2011) that the bacterial counts were extremely located in the central part of the coast of Alexandria, particularly during spring and winter. Bacteria with antagonistic activity highly existed in sediments of Eastern Harbor, El-Shatby, Sidi Bishr, and Abuqir as highly polluted sites, while in the other coasts (the Red Sea coasts) it existed less. These data may also suggest that the Mediterranean Sea coastline is more polluted than the Red Sea coastline. In agreement with our results, previous researches have described significant changes and lower diversity in aquatic bacterial communities, compared to comparatively more polluted coastal areas (Schauer et al., 2000; Ghiglione et al., 2005; Ullah et al., 2019).
Based on locations, bacterial isolates (MO1−MO35) were isolated from sediment samples collected from the previously mentioned sites (Table 2). Out of the total isolates, 14 Gram-negative (40%) and 21 Gram-positive bacteria (60%) were detected. This is an adverse percentage with the results obtained by Hassan et al. (2016) as the isolates were observed to be Gram-negative (59.1%), while 40.9% displayed the Gram-positive organisms. However, some studies revealed that all isolates were Gram-positive (Attimarad et al., 2012; Syakti et al., 2019), while other studies revealed that all isolates were Gram-negative (Gupta et al., 2015a, b). After isolation, the total isolates were screened for antimicrobial agent(s) production.
Numerical taxonomy includes the collection of identifiable characteristics of the microorganisms, involving genetic relationships and has been applied for microbial taxonomy leading to reliable improvement in isolates identification (Kim, 2010).
The representative of all bacterial morphotypes observed from each sample was picked from primary recovered cultures and then stepwise purified on NA medium. Out of 122 bacterial colonies, 35 colonies were selected for numerical classification and antimicrobial activity studies (isolates codes MO1, MO2, MO5, MO7, and MO12 from the Eastern Harbor; isolates codes MO3, MO4, MO11, and MO13 from El-Shatby; isolate codes MO6, MO8, MO19, MO22, and MO26 from Sidi Bishr; isolates codes MO9, MO15, MO23, and MO35 from Abuqir; isolates code MO10 from El-Gouna; isolates codes MO14, MO16, and MO30 from NIOF Hurghada; isolates codes MO17, MO18, and MO33 from Safaga Station; isolates codes MO20, MO21, MO27, and MO29 from Marsa Alam; and isolates codes MO24, MO25, MO28, MO31, MO32, and MO34 from the Shalatin Station). All isolates were identified depending upon the physiological, morphological, and microscopical studies. Das et al. (2019) indicated that the morpho-physio-biochemical characters including the colony characters were not identical which proved that the structure and functions of the bacteria were different.
In our study, physiological and biochemical characteristics were detected for all 35 marine isolates. No unique physiological and biochemical features were detected among these isolates. A similarity matrix was constructed based on the positive or negative physiological and biochemical characteristics for each isolate which was scored as 1 and 0, respectively. At 85% similarity level, 13 clusters were obtained (A, B, C, D, E, F, G, H, I, J, K, L, and M). The colony colors of all isolates were varied between yellow, golden-yellow, or slightly yellow color. The cluster analysis of the 35 isolates was carried out using PRIMER MeV 4.9.0 software according to their various characters. The dendrogram for 35 isolates was carried out using MEGA_X_10.1.6 software.
Bacteria produce protective compounds to protect themselves from any foreign organisms some of these have antimicrobial activity (Bhatnagar and Kim, 2010). The isolated bacterial strains were screened for their potentiality for antimicrobial agent(s) production against ten indicator strains. Displaying the varied spectra of antimicrobial actions was the aim behind the choice of these pathogens (Al-Amoudi et al., 2016). This wide spectrum activity is very common in marine bacteria (Abdel-Shakour et al., 2015). In our study, of the 35 isolates screened, 28 isolates showed potential antimicrobial activity evidenced through growth inhibition against at least one of the indicator strains as shown in Table 2. MO13 isolate exhibited both antibacterial and antifungal activity against the tested pathogenic indicators. Accordingly, the MO13 isolate was selected as the most potent isolate with a broad spectrum of antimicrobial activity in this study. According to Helal et al. (2018) who reported that 7 out of 80 bacterial isolates from the Red Sea showed antimicrobial activity against 5 reference strains, and the most potent isolate had been identified as Bacillus amyloliquefaciens which exhibited significant results against Gram-negative bacteria, Gram-positive bacteria, and yeasts. As well, fifty bacterial isolates were recovered from the invertebrates from the Red Sea, out of them, 5 isolates showed antifungal activities against Candida albicans (El Samak et al., 2018).
The most promising marine bacterial isolate (MO13) regarding the antimicrobial activity was submitted to the phenotypic characterization through morphological, physiological, and biochemical tests and submitted to genotypic characterization through the 16S rDNA technique.
The isolate (MO13) was grown on a nutrient agar plate with seawater. Some phenotypic characteristics of the selected isolate including colony and cell morphology, Gram reaction, catalase, and oxidase test in addition to some physiological and biochemical experiments have been depicted in Table 3. The results showed that isolate MO13 is a Gram-positive, Bacillus bacterium. It grew at 10−45°C, pH range 5−9, catalase, oxidase, Voges Proskauer, and glucose utilization are positive as shown in Table 3.
Genomic DNA of the bacterial isolates MO13 was prepared, and the gene coding for the 16S rRNA was partially amplified using the universal primers (16S 27F and 16S 1492R). The amplified PCR fragment was purified and then sequenced. A valid sequencing fragment data (1492 bp) was aligned against the 16S rRNA sequences (http://blast.ncbi.nlm.nih.gov/Blast.cgi). According to the analyses of the 16S rRNA sequence of the bacterial isolate MO13; it showed a high similarity to level with Bacillus species; in particular, B. zhangzhouensis. Subsequently, its rDNA sequence had been submitted on gene bank and it takes an accession number of MT269497.1 and finally designated as B. zhangzhouensis strain OMER4 (Fig. 1). The phylogenetic tree of B. zhangzhouensis strain OMER4 was carried out using MEGA_X_10.1.6 software.
Bacillus zhangzhouensis first isolated from shrimp farm aquaculture water in Zhangzhou, China. The DNA G+C content of the type strain is 41.4% (mole percentage) (Liu et al., 2016). Recently, Karagoz et al. (2018) identified B. zhangzhouensis by 16S rRNA gene sequencing and the isolate has been proven to be an important agent in biocontrol of popular scab disease caused by Streptomyces scabies and have the ability of solubilizing phosphate and fixing nitrogen. Bacillus has gained a high degree of interest among bacterial genera because it produces a wide range of beneficial biomaterials that are very useful for the agricultural, food, chemical, and pharmaceutical sectors (Roongsawang et al., 2011).
Members of the genus Bacillus have recently been shown to generate a wide range of antimicrobial compounds against several microbial pathogens (Wu et al., 2018; Kelany et al., 2019). In agreement with our study, numerous previous researches have indicated that many Bacillus species isolated from sea sediments have shown more antagonism to Gram-positive bacteria, but less to Gram-negative bacteria (Kannahi and Eshwari, 2016; Sawale and Thivakaran, 2013). It may be attributed to variations in the composition of Gram-positive and Gram-negative bacteria in the cell wall. Apart from Gram-positive bacteria, which has only one thick cell wall, Gram-negative bacteria have much more complicated structures in which antimicrobial peptides have to be crossed to associate with their molecules required during cell wall biosynthesis (Malanovic and Lohner, 2016).
Different solvents including ethyl acetate, chloroform, n-hexane (95%), and n-butanol were tested for their efficiency to extract the desired bioactive compounds. The crude extract resulting in using solvent was tested for its antimicrobial activity against the previously mentioned microbial indicators. The results revealed that ethyl acetate was the most efficient solvent for extracting the desired compounds and realized the highest antimicrobial activity. In agreement with our findings, ethyl acetate has been used as the best solvent for extraction of antimicrobial compounds from several Bacillus sp. (Berić et al., 2012; Malash et al., 2016; Farag et al., 2019).
The components of ethyl acetate crude extract were exposed to GC-MS analysis to preliminarily identify its components. As shown in Fig. 2a, the major constituent in the ethyl acetate crude extract at retention time 13.873 min was expected as Phenol, 2, 4-bis(1, 1-dimethyl ethyl). Figure 2b corresponds to molecular weight 206.16 g/mol and formula C14H22O. The mass spectrum of Phenol, 2, 4-bis(1, 1-dimethyl ethyl) is presented in Fig. 3.
The marine environment has a variety of macro-and microorganisms that have evolved specific metabolic capabilities to ensure their survival in varied and hostile environments, resulting in the biosynthesis of an array of secondary metabolites with specific activities. Several of these metabolites are high-value commercial products for the pharmaceutical and cosmeceutical industries (Martins et al., 2014). Phenol, 2, 4-bis(1, 1-dimethyl ethyl) (PD) (Fig. 3) also called 2, 4-Di-tert-butylphenol, 2, 4-di-t-Butylphenol, 1-Hydroxy-2, 4-di-tert-butylbenzene, Antioxidant No. 33, Prodox 146A-85X and 2, 4-bis(tert-butyl) phenol. PD has been reported from various bacterial sources with antibacterial, antifungal, antioxidant, anti-biofilm, anticancer, and anti-inflammatory properties (do Amaral et al., 2014; Rao et al., 2015).
Previous studies reported the antifungal ability of PD against Colletotrichum acutatum, Fusarium oxysporum, and Phytophthora capsici (Sang et al., 2011; Sang and Kim, 2012; Dharni et al., 2014). A previous study suggested that PD changes the integrity of cell membranes to produce the antifungal effect against Phytophthora cinnamomi (Rangel-Sánchez et al., 2014; Teresa et al., 2014). However, in the other study, the PD of bacterial origin and the commercial compound did not exhibit any bactericidal effects. Apart from inhibiting and destroying biofilm, PD improved the sensitivity of Serratia marcescens to gentamicin when given symbiotically, providing another pathway for combination therapy where PD can be used to enhance the efficiency of traditional antibiotics (Padmavathi et al., 2014).
Microorganisms still represent a very important tool for multiple purposes, one of those roles is antibiosis by which the bacteria produce potential antimicrobial agents that cause inhibition of a wide range of other microorganisms including other genera of bacteria, yeasts, and other filamentous fungi. In the current study, screening of marine bacteria along two coastal lines in Egypt (the Red Sea and the White Mediterranean Sea) succeeded to isolate B. zhangzhouensis strain OMER4 which fortunately has a promising antimicrobial potential against a wide range of the test microorganisms including Gram-positive, Gram-negative bacteria and fungi. Ethyl acetate exhibits better results than the other investigated solvents, GC-MS is a very helpful tool to predict the active metabolites produced by the bacterial strain particularly, by using the most appropriate solvent which could dissolve the active metabolite to a degree that surpasses the other undesirable metabolites. The problem of multidrug resistance to antibiotics increased for several reasons, hence, there is a crucial need to incorporate new effective generations of antibiotics into the pharmaceutical market, and this study attempt to offer a natural effective antimicrobial agent to overcome the antimicrobial resistance. Our findings may contribute as a promising solution to the microbial infections which threaten the lives of humans, animals, as well as plants.
Abdel-Razek A S, El-Sheikh H H, Suleiman W B, et al. 2020. Bioelimination of phenanthrene using degrading bacteria isolated from petroleum soil: safe approach. Desalination and Water Treatment, 181: 131–140, doi: 10.5004/dwt.2020.25109
Abdel-Shakour E H, Qari S H M, Beltagy E A, et al. 2015. Assessment of antimicrobial, antioxidant and enzyme inhibitory activities of Streptomyces sp. Nyr04 (KT074931) isolated from mangrove sediment in Red Sea (Egypt). Wulfenia, 22(10): 472–481
Al-Allaf M A A. 2011. Isolation of Bacillus spp. from some sources and study of its proteolytic activity. Tikrit Journal of Pure Science, 16(4): 59–63
Al-Amoudi S, Essack M, Simões M F, et al. 2016. Bioprospecting Red Sea coastal ecosystems for culturable microorganisms and their antimicrobial potential. Marine Drugs, 14(9): 165, doi: 10.3390/md14090165
Amer M S, Ibrahim H A H. 2019. Chitosan from marine-derived Penicillum spinulosum MH2 cell wall with special emphasis on its antimicrobial and antifouling properties. The Egyptian Journal of Aquatic Research, 45(4): 359–365, doi: 10.1016/j.ejar.2019.11.007
Attimarad S L, Ediga G N, Karigar A A, et al. 2012. Screening, isolation and purification of antibacterial agents from marine actinomycetes. International Current Pharmaceutical Journal, 1(12): 394–402, doi: 10.3329/icpj.v1i12.12448
Barzkar N, Jahromi S T, Poorsaheli H B, et al. 2019. Metabolites from marine microorganisms, micro, and macroalgae: immense scope for pharmacology. Marine Drugs, 17(8): 464, doi: 10.3390/md17080464
Berić T, Kojić M, Stanković S, et al. 2012. Antimicrobial activity of Bacillus sp. natural isolates and their potential use in the biocontrol of phytopathogenic bacteria. Food Technology and Biotechnology, 50(1): 25–31
Bhatnagar I, Kim S K. 2010. Immense essence of excellence: marine microbial bioactive compounds. Marine Drugs, 8(10): 2673–2701, doi: 10.3390/md8102673
Bowen B W, Rocha L A, Toonen R J, et al. 2013. The origins of tropical marine biodiversity. Trends in Ecology & Evolution, 28(6): 359–366
Das P, Chatterjee S, Behera B K, et al. 2019. Isolation and characterization of marine bacteria from East Coast of India: functional screening for salt stress tolerance. Heliyon, 5(6): E01869, doi: 10.1016/j.heliyon.2019.e01869
Dharni S, Srivastava A K, Samad A, et al. 2014. Impact of plant growth promoting Pseudomonas monteilii PsF84 and Pseudomonas plecoglossicida PsF610 on metal uptake and production of secondary metabolite (monoterpenes) by rose-scented geranium (Pelargonium graveolens cv. bourbon) grown on tannery sludge amended soil. Chemosphere, 117: 433–439, doi: 10.1016/j.chemosphere.2014.08.001
Dias D A, Urban S, Roessner U. 2012. A historical overview of natural products in drug discovery. Metabolites, 2(2): 303–336, doi: 10.3390/metabo2020303
DiBattista J D, Berumen M L, Gaither M R, et al. 2013. After continents divide: comparative phylogeography of reef fishes from the Red Sea and Indian Ocean. Journal of Biogeography, 40(6): 1170–1181, doi: 10.1111/jbi.12068
do Amaral F M D, de Fátima de Araújo Vieira M, de Melo K V, et al. 2014. The role of environmental education in changing school students’ perceptions of and attitudes toward coral reefs in the Fernando de Noronha Archipelago, Brazil. Revista de Gestã o Costeira Integrada-Journal of Integrated Coastal Zone Management, 14(4): 581–590
El-Bestawy E, El-Shenway M, Abou-Elela G, et al. 2011. Identification and distribution of antimicrobial-active marine bacteria along the heavily polluted coastal area of Alexandria, Egypt. Water Science & Technology, 63(6): 1081–1092
El-Hossary E M, Abdel-Halim M, Ibrahim E S, et al. 2020. Natural products repertoire of the Red Sea. Marine Drugs, 18(9): 457, doi: 10.3390/md18090457
El-Naggar M Y, El-Assar S A, Youssef A S, et al. 2006. Extracellular β-mannanase production by the immobilization of the locally isolated Aspergillus niger. International Journal of Agriculture & Biology, 8(1): 57–62
El Samak M, Solyman S M, Hanora A. 2018. Antimicrobial activity of bacteria isolated from Red Sea marine invertebrates. Biotechnology Reports, 19: e00275, doi: 10.1016/j.btre.2018.e00275
Elkhateeb W, El-Sayed H, Fayad W, et al. 2020. In vitro Anti-breast cancer and antifungal Bio-efficiency of some microalgal extracts. Egyptian Journal of Aquatic Biology and Fisheries, 24(1): 263–279, doi: 10.21608/ejabf.2020.70448
Farag A M, Mohammed A M, Afifi M M, et al. 2019. Isolation, optimization and production of antimicrobial agent from a novel producer Bacillus badius strain AAUM. The Egyptian Journal of Experimental Biology (Botany), 15(2): 135–146
Gad A M, Beltagy E A, Abdul-Raouf U M, et al. 2016. Screening of marine fatty acids producing bacteria with antimicrobial capabilities. Chemistry of Advanced Materials, 1(2): 41–54
Ghiglione J F, Larcher M, Lebaron P. 2005. Spatial and temporal scales of variation in bacterioplankton community structure in the NW Mediterranean Sea. Aquatic Microbial Ecology, 40(3): 229–240
Gupta P, Agrawal H K, Bandopadhyay R. 2015a. Distribution pattern of bacteria in the two geographic poles and Southern Ocean from the reported 16S rDNA sequences. Current Science, 108(10): 1926–1930
Gupta P, Balaji R, Parani M, et al. 2015b. Phylogenetic analysis and biological characteristic tests of marine bacteria isolated from Southern Ocean (Indian sector) water. Acta Oceanologica Sinica, 34(8): 73–82, doi: 10.1007/s13131-015-0709-5
Hashem A H, Hasanin M S, Khalil A M A, et al. 2020a. Eco-green conversion of watermelon peels to single cell oils using a unique oleaginous fungus: Lichtheimia corymbifera AH13. Waste and Biomass Valorization, 11(11): 5721–5732, doi: 10.1007/s12649-019-00850-3
Hashem A H, Suleiman W B, Abu-Elreesh G, et al. 2020b. Sustainable lipid production from oleaginous fungus Syncephalastrum racemosum using synthetic and watermelon peel waste media. Bioresource Technology Reports, 12: 100569, doi: 10.1016/j.biteb.2020.100569
Hashem A H, Suleiman W B, Abu-Elrish G M, et al. 2021. Consolidated bioprocessing of sugarcane bagasse to microbial oil by newly isolated oleaginous fungus: Mortierella wolfii. Arabian Journal for Science and Engineering, 46(1): 199–211, doi: 10.1007/s13369-020-05076-3
Hassan W, Rehman S, Noreen H, et al. 2016. Gas chromatography mass spectrometric (GCMS) analysis of essential oils of medicinal plants. Advances in Animal and Veterinary Sciences, 4(8): 420–437, doi: 10.14737/journal.aavs/2016/4.8.420.437
Helal H S, Hanora A, Khattab R A, et al. 2018. Mining of Egypt’s Red Sea invertebrates for potential bioactive producers. Biotechnology Letters, 40(11): 1519–1530
Kannahi M, Eshwari N T. 2016. Extraction, purification and antibacterial activity of bioactive compounds from marine Bacillus species. International Journal of Pure & Applied Bioscience, 4(4): 244–254
Karagoz K, Dadasoglu F, Mohammadi P, et al. 2018. Screening bacterial antagonists to common scab disease. Journal of Animal and Plant Sciences, 28(4): 1068–1073
Kelany M S, Beltagy E A, Khalil M A E F, et al. 2019. Isolation, characterization, and detection of antibacterial activity of a bioactive compound produced by marine Bacillus sp. MH20 from Suez Bay, Egypt. Novel Research in Microbiology Journal, 3(1): 258–270, doi: 10.21608/nrmj.2019.28112
Kim B Y. 2010. Biosystematics of the genus Dactylosporangium and some other filamentous actinomycetes [dissertation]. Newcastle: Newcastle University
Lejeusne C, Chevaldonné P, Pergent-Martini C, et al. 2010. Climate change effects on a miniature ocean: the highly diverse, highly impacted Mediterranean Sea. Trends in Ecology & Evolution, 25(4): 250–260
Liu Yang, Lai Qiliang, Du Juan, et al. 2016. Bacillus zhangzhouensis sp. nov. and Bacillus australimaris sp. nov. International Journal of Systematic and Evolutionary Microbiology, 66(3): 1193–1199, doi: 10.1099/ijsem.0.000856
López Y, Cepas V, Soto S M. 2018. The marine ecosystem as a source of antibiotics. In: Rampelotto P H, Trincone A, eds. Grand Challenges in Marine Biotechnology. Cham: Springer, 3–48
Malanovic N, Lohner K. 2016. Antimicrobial peptides targeting gram-positive bacteria. Pharmaceuticals, 9(3): 59, doi: 10.3390/ph9030059
Malash M A, El-Naggar M M, El Hassayeb H E A, et al. 2016. Production of antimicrobial Pyrrol-Derivatives acting against some fish pathogens from marine Bacillus pumilus mmm. Global Veterinaria, 17(6): 495–504
Manivasagan P, Venkatesan J, Sivakumar K, et al. 2013. RETRACTED: marine actinobacterial metabolites: current status and future perspectives. Microbiological Research, 168(6): 311–332, doi: 10.1016/j.micres.2013.02.002
Martins A, Vieira H, Gaspar H, et al. 2014. Marketed marine natural products in the pharmaceutical and cosmeceutical industries: Tips for success. Marine Drugs, 12(2): 1066–1101, doi: 10.3390/md12021066
Padmavathi A R, Abinaya B, Pandian S K. 2014. Phenol, 2, 4-bis (1, 1-dimethylethyl) of marine bacterial origin inhibits quorum sensing mediated biofilm formation in the uropathogen Serratia marcescens. Biofouling, 30(9): 1111–1122, doi: 10.1080/08927014.2014.972386
Patridge E, Gareiss P, Kinch M S, et al. 2016. An analysis of FDA-approved drugs: natural products and their derivatives. Drug Discovery Today, 21(2): 204–207, doi: 10.1016/j.drudis.2015.01.009
Rangel-Sánchez G, Castro-Mercado E, García-Pineda E. 2014. Avocado roots treated with salicylic acid produce phenol-2, 4-bis (1, 1-dimethylethyl), a compound with antifungal activity. Journal of Plant Physiology, 171(3–4): 189–198
Rao M R K, Philip S, Kumar M H, et al. 2015. GC-MS analysis, antimicrobial, antioxidant activity of an Ayurvedic medicine, Salmali Niryasa. Journal of Chemical and Pharmaceutical Research, 7(7): 131–139
Rédou V, Navarri M, Meslet-Cladière L, et al. 2015. Species richness and adaptation of marine fungi from deep-subseafloor sediments. Applied and Environmental Microbiology, 81(10): 3571–3583, doi: 10.1128/AEM.04064-14
Rohlf F J. 1987. NTSYS-pc: Microcomputer programs for numerical taxonomy and multivariate analysis. The American Statistician, 41(4): 330, doi: 10.2307/2684761
Roongsawang N, Washio K, Morikawa M. 2011. Diversity of nonribosomal peptide synthetases involved in the biosynthesis of lipopeptide biosurfactants. International Journal of Molecular Sciences, 12(1): 141–172
Sang M K, Kim K D. 2012. The volatile-producing Flavobacterium johnsoniae strain GSE09 shows biocontrol activity against Phytophthora capsici in pepper. Journal of Applied Microbiology, 113(2): 383–398, doi: 10.1111/j.1365-2672.2012.05330.x
Sang M K, Kim J D, Kim B S, et al. 2011. Root treatment with rhizobacteria antagonistic to Phytophthora blight affects anthracnose occurrence, ripening, and yield of pepper fruit in the plastic house and field. Phytopathology, 101(6): 666–678, doi: 10.1094/PHYTO-08-10-0224
Sawale A K, Thivakaran G A. 2013. Structural characteristics of mangrove forest of Kachchh, Gujarat. Journal of the Marine Biological Association of India, 55(1): 01735–01
Schauer M, Massana R, Pedrós-Alió C. 2000. Spatial differences in bacterioplankton composition along the Catalan coast (NW Mediterranean) assessed by molecular fingerprinting. FEMS Microbiology Ecology, 33(1): 51–59, doi: 10.1111/j.1574-6941.2000.tb00726.x
Sekurova O N, Schneider O, Zotchev S B. 2019. Novel bioactive natural products from bacteria via bioprospecting, genome mining and metabolic engineering. Microbial Biotechnology, 12(5): 828–844, doi: 10.1111/1751-7915.13398
Skropeta D, Wei Liangqian. 2014. Recent advances in deep-sea natural products. Natural Product Reports, 31(8): 999–1025, doi: 10.1039/C3NP70118B
Suleiman W B. 2017. Detection of mec a gene in multidrug resistant Staphylococcus aureus isolate from Egyptian patients. Al-Azhar Bulletin of Science, 9: 357–363
Suleiman W B. 2020. In vitro estimation of superfluid critical extracts of some plants for their antimicrobial potential, phytochemistry, and GC–MS analyses. Annals of Clinical Microbiology and Antimicrobials, 19(1): 29, doi: 10.1186/s12941-020-00371-1
Suleiman W B, El Bous M M, El Said M, et al. 2019. In vitro evaluation of Syzygium aromaticum L. ethanol extract as biocontrol agent against postharvest tomato and potato diseases. Egyptian Journal of Botany, 59(1): 81–94
Syakti A D, Lestari P, Simanora S, et al. 2019. Culturable hydrocarbonoclastic marine bacterial isolates from Indonesian seawater in the Lombok Strait and Indian Ocean. Heliyon, 5(5): e01594, doi: 10.1016/j.heliyon.2019.e01594
Teresa R C M, Rosaura V G, Elda C M, et al. 2014. The avocado defense compound phenol-2, 4-bis (1, 1-dimethylethyl) is induced by arachidonic acid and acts via the inhibition of hydrogen peroxide production by pathogens. Physiological and Molecular Plant Pathology, 87: 32–41, doi: 10.1016/j.pmpp.2014.05.003
Ullah R, Yasir M, Bibi F, et al. 2019. Taxonomic diversity of antimicrobial-resistant bacteria and genes in the Red Sea coast. Science of the Total Environment, 677: 474–483, doi: 10.1016/j.scitotenv.2019.04.283
Wu Jia, Xu Guoqiang, Jin Yangyang, et al. 2018. Isolation and characterization of Bacillus sp. GFP-2, a novel Bacillus strain with antimicrobial activities, from whitespotted bamboo shark intestine. AMB Express, 8(1): 84, doi: 10.1186/s13568-018-0614-3
Year 2022 volume 41 Issue 3
PDF
133
72
Cite this Article
BibTeX
Article Info
doi: 10.1007/s13131-021-1926-8
  • Receive Date:2021-02-07
  • Online Date:2025-11-21
  • Published:2022-03-25
Article Data
Affiliations
History
  • Received:2021-02-07
  • Accepted:2021-03-26
Affiliations
    1 Department of Botany and Microbiology, Faculty of Science, Al-Azhar University, Cairo 11884, Egypt
    2 The Regional Center for Mycology and Biotechnology, Al-Azhar University, Cairo 11884, Egypt
    3 Microbiology Laboratory, Marine Environmental Division, National Institute of Oceanography and Fisheries, Alexandria 11865, Egypt

Corresponding:

* dr_wbs@azhar.edu.eg
References
Share
https://castjournals.cast.org.cn/joweb/aos/EN/10.1007/s13131-021-1926-8
Share to
QR

Scan QR to access full text

Cite this article
BibTeX
Citations
表12种不同金属材料的力学参数

Family
属数
Number of
genus
种数
Number of
species
占总种数比例
Percentage of
total species (%)

Genus
种数
Number of
species
占总种数比例
Percentage of total
species (%)
鹅膏菌科Amanitaceae 2 11 5.26 鹅膏菌属 Amanita 10 4.78
小菇科 Mycenaceae 2 12 5.74 丝盖伞属 Inocybe 5 2.39
多孔菌科 Polyporaceae 8 14 6.70 蜡蘑属 Laccaria 5 2.39
红菇科 Russulaceae 3 23 11.00 小皮伞属 Marasmius 6 2.87
小菇属 Mycena 11 5.26
光柄菇属 Pluteus 5 2.39
红菇属 Russula 17 8.13
栓菌属 Trametes 5 2.39
关闭全屏
  • BibTeX
  • EndNote
  • RefWorks
  • TxT