收藏切换
Characterization of a broad substrates specificity acyl-CoA: diacylglycerol acyltransferase 1 from the green tide alga Ulva prolifera
收藏切换
PDF
Xiaowen Zhang1, 2, , Xiaoyuan Chi3, , Yitao Wang1, Jian Zhang4, Yan Zhang1, Dong Xu1, Xiao Fan1, Chengwei Liang4, Naihao Ye1, 2, *
Acta Oceanologica Sinica | 2020, 39(10) : 42 - 49
Less
收藏切换
Acta Oceanologica Sinica | 2020, 39(10): 42-49
Recent Research on the Yellow Sea Green Tide Caused by Ulva prolifera
Characterization of a broad substrates specificity acyl-CoA: diacylglycerol acyltransferase 1 from the green tide alga Ulva prolifera
Full
Xiaowen Zhang1, 2, , Xiaoyuan Chi3, , Yitao Wang1, Jian Zhang4, Yan Zhang1, Dong Xu1, Xiao Fan1, Chengwei Liang4, Naihao Ye1, 2, *
Affiliations
  • 1 Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China
  • 2 Function Laboratory for Marine Fisheries Science and Food Production Processes, Pilot National Laboratory for Marine Science and Technology (Qingdao), Qingdao 266237, China
  • 3 Shandong Peanut Research Institute, Qingdao 266100, China
  • 4 College of Marine Science and Biological Engineering, Qingdao University of Science and Technology, Qingdao 266042, China
Published: 2020-10-25 doi: 10.1007/s13131-020-1659-0
Outline
收藏切换

Triacylglycerols (triglycerides, TAGs) are the major carbon and energy storage forms in various organisms, and important components of cellular membranes and signaling molecules; they have essential functions in multiple physiological processes and stress regulation. Acyl-CoA: diacylglycerol acyltransferase (DGAT) catalyzes the final and only committed acylation step in the synthesis of TAGs in eukaryotes. The present work identified and isolated a novel gene, UpDGAT1, from the green tide alga Ulva prolifera. The activity of UpDGAT1 was confirmed by heterologous expression in a Saccharomyces cerevisiae TAG-deficient quadruple mutant. Results of thin-layer chromatography and BODIPY staining indicated that UpDGAT1 was able to restore TAG synthesis and lipid body formation in the yeast. Lipid analysis of yeast cells revealed that UpDGAT1 showed broad substrate specificity, accepting saturated as well as mono- and polyunsaturated acyl-CoAs as substrates. High salinity and high temperature stresses increased UpDGAT1 expression and TAG accumulation in U. prolifera. The present study provides clues to the functions of UpDGAT1 in TAG accumulation in, and stress adaptation of, U. prolifera.

Ulva prolifera  /  diacylglycerol acyltransferase  /  triacylglycerol  /  stress
Xiaowen Zhang, Xiaoyuan Chi, Yitao Wang, Jian Zhang, Yan Zhang, Dong Xu, Xiao Fan, Chengwei Liang, Naihao Ye. Characterization of a broad substrates specificity acyl-CoA: diacylglycerol acyltransferase 1 from the green tide alga Ulva prolifera[J]. Acta Oceanologica Sinica, 2020 , 39 (10) : 42 -49 . DOI: 10.1007/s13131-020-1659-0
Lipids are the major carbon and energy storage forms in various organisms, including vertebrates, oilseed plants, oleaginous fungi, yeasts, and algae. They are also important components of cellular membranes and signaling molecules, with essential functions in multiple physiological processes and stress regulation (Chen et al., 2011). As sessile organisms, plants and maroalgae are exposed to many types of biotic and abiotic stresses under their natural conditions. Plants can sense these stimuli and use lipids as substrates for the generation of numerous signalling lipids, such as phosphatidic acid, phosphoinositides, sphingolipids, oxylipins, free fatty acids and others, and transduce these signals into downstream biological responses (Hou et al., 2016).
Neutral lipid triacylglycerols (triglycerides, TAGs) are mainly assembled by the enzymes of Kennedy pathway in the endoplasmic reticulum (ER), where acyl chains are sequentially transferred from -CoAs to the sn-1, -2 and -3 positions of a glycerol backbone (Ohlrogge and Browse, 1995). Diacylglycerol acyltransferase (DGAT, EC 2.3.1.20), which is thought to be the primary and rate-limiting enzyme for de novo TAG biosynthesis in all organisms studied so far, catalyzes the last and committed step in TAG production by transferring an acyl group to diacylglycerol (Chen and Smith, 2012). There are at least two major families of DGATs, named Type 1 (DGAT1) and Type 2 (DGAT2), which are membrane-bound and catalyze the same reaction, but have no clear sequence similarities. A cytosolic DGAT Type 3 that is thought to be involved in the cutin biosynthesis pathway has also been reported in several plant species (Rani et al., 2010), but its role in TAG biosynthesis is still unclear. DGAT1 shows high sequence homology with mammalian acyl-CoA/cholesterol acyltransferases (EC 2.3.1.26). It was first described in mouse, and subsequently in several plant and algal species (Chen and Smith, 2012; Roesler et al., 2016). Though DGAT1 and DGAT2 catalyze the same reaction, the two enzymes have no redundant functions in TAG biosynthesis (Guihéneuf et al., 2011). In plants, several studies showed that DGAT1 plays a dominant role in the determination of oil accumulation and fatty acid composition (Xu et al., 2008; Taylor et al., 2009; Savadi et al., 2016; Wang et al., 2019; Kim et al., 2016). In Arabidopsis thaliana, mutations in DGAT1, but not DGAT2, affected seed oil levels (Xu et al., 2008), and overexpression of DGAT1 led to increased seed oil content in Brassica napus (Weselake et al., 2008; Taylor et al., 2009), B. juncea (Savadi et al., 2016), soybean (Glycine max) (Roesler et al., 2016), maize (Zea mays) (Zheng et al., 2008), tobacco (Nicotiana tabacum) (Andrianov et al., 2010), and A. thaliana (Misra et al., 2013).
The basic mechanism of lipid synthesis in algae was assumed to be the same as that in land plants, which is supported by in silico analysis as many sequences in algal genomes seem likely to encode the relevant enzymes for TAG biosynthesis (Hu et al., 2008; Miller et al., 2010). However, algae are phylogenetically very diverse, and it is becoming clear that for most algal species, even for those that fall into the green algal lineage, there are some notable differences (Chen and Smith, 2012; Brodie et al., 2017). With regard to the DGATs, the majority of algal species encode at least one DGAT1 gene, but it appears to be absent from Ostreococcus and Micromonas (Chen and Smith, 2012). Several biochemical and functional studies on DGATs have been carried out in unicellular microalgae, such as Phaeodactylum tricornutum (Niu et al., 2013), C. reinhardtii (Russa et al., 2012), Chlorella zofngiensis (Mao et al., 2019), Ostreococcus tauri (Wagner et al., 2010), Tetraselmis chui (Úbeda-Mínguez et al., 2017) and Nannochloropsis oceanica (Li et al., 2016), Myrmecia incisa (Chen et al., 2015). However, the mechanism of TAG synthesis in seaweed remains poorly understood.
Ulvophyte green seaweeds represent attractive model systems for understanding growth, development, and evolution. They are untapped resources for production of food, fuel, and high-value compounds, but they can also cause significant environmental problems in the form of green tides and biofouling (Vesty et al., 2015; Callow and Callow, 2006a, b; Smetacek and Zingone, 2013). Massive green tides, which are mainly caused by Ulva prolifera have occurred for 13 successive years (2007–2019) in the Yellow Sea (Zhang et al., 2019). Unlike land plants and unicellular green algae, mechanistic studies of growth and development at the molecular level in green seaweeds are severely limited. In the present study, we report the identification and characterization of a DGAT1-encoding gene (UpDGAT1) from U. prolifera, whose function was confirmed by expression in the yeast Saccharomyces cerevisiae.
Floating samples of U. prolifera were collected in July 2017 from the Zhanqiao Wharf (35°35′N, 119°30′E), Qingdao, China. In the laboratory, the intact samples were washed several times with sterile seawater, and then rinsed with autoclaved seawater. The U. prolifera samples were then placed into an aquarium containing enriched seawater (500 mmol/L NaNO3 and 50 mmol/L NaH2PO4), and maintained at 15°C under a cycle comprising 12 of light alternating with 12 h of darkness. The light intensity was 100 μmol/(m2·s) provided by cool-white fluorescent tubes. Samples used for real-time PCR were treated with high light (2 000 μmol/(m2·s) for 1 h), high temperature (30°C for 24 h), high salinity (66 for 24 h) and low salinity (16 for 24 h).
The cDNA sequences used in this study came from U. prolifera transcriptome (SRR3524808, SRR3504905). The amino acid sequences of the five DGAT genes of Ulva mutabilis (UM011_0232.1, UM022 0045.1, UM020_0139.1, UM020_0128.1, UM059_0034.1) were used as query to search for homologous genes from the U. prolifera transcriptome sequences. The deduced amino-acid sequence of UpDGAT gene was examined for homology with other known sequences by using the Muscle of the MEGA 7.0 program (Kumar et al., 2016). Its domain was predicted in Pfam HMM (http://pfam.sanger.ac.uk/search), and whether there is a membrane-spanning helix structure in this sequence was predicted by HMMTOP (http://www.enzim.hu/hmmtop/html/submit.html). The phylogenetic tree was constructed by the neighbor-joining algorithm of the MEGA 7.0 program (Kumar et al., 2016). A total of 1000 bootstrap replicates were performed.
Total RNA of U. prolifera samples exposed to each form and level of stress was extracted using Trizol Reagent (Invitrogen) as specified in the user’s manual and dissolved in diethylpyrocarbonate (DEPC)-treated water. The genomic DNA was removed by DNase I (RNase free) (NEB) from the total RNA samples. The cDNA used for real-time PCR was synthesized from the total RNA by Moloney Murine Leukemia Virus (MMLV) reverse transcriptase (Promega).
The real-time quantitative PCRs were performed with ABI StepOne Plus Real-Time PCR System (Applied Biosystems) using SYBR Green fluorescence (Takara) according to the manufacturer’s instructions. A 111 bp product of UpDGAT1 was amplified with DGATF1 (TGA TGC TGT TCC TGG TGG AC) and DGATR1 (GGG AGA GCT TCA GGA TAC GC). Primers of Tub1F (CCG ATG GGC AAG TAA TCAC) and Tub1R (TGA AGG TTG TAT CAT GGA CTCC) were used to amplify a 139 bp fragment of tubulin as an internal control (Dong et al., 2012). The thermal profile for real-time PCR was 30 s followed by 40 cycles at 95°C for 5 s, 55°C for 10 s, and 72°C for 30 s. Dissociation curve analysis of the amplification products was performed at the end of each PCR to confirm that only one specific PCR product was amplified and detected. Triplicate qPCRs were performed for each sample.
The coding sequences of UpDGAT1 was amplified with gene specific primers (DAGTSEf: TCGAATTCATGACACAAGCTCTT; DAGTSEr: TCTCTAGACTATGCCATCGCTGA) containing the appropriate restriction sites to facilitate cloning into the yeast expression vector pYES2/CT (Invitrogen). The UpDGAT1 cds sequence was cloned into the pYES2 plasmid and was then transformed into the yeast quadruple mutant H1246MATa (dga1Δ lroΔ are1Δ are2Δ) which is deficient in oil synthesis by poly (ethylene glycol)/lithium acetate method according to the manual (Invitrogen). The auxotrophic Saccharomyces cerevisiae strain INVSc1 (MATa his3-∆1 leu2 trp1-289 ura3-52) was used as positive control. Yeast cells transformed with an empty pYES2 plasmid were used as negative control. Yeast transformants were selected by growth on synthetic complete medium lacking uracil (SC-ura), supplemented with 2% glucose. The colonies were transferred into liquid SC-ura with 2% glucose and grown at 28°C overnight. The overnight cultures were diluted to A=0.4 in induction medium (SC-ura+2% galactose+1% raffinose) and were induced by incubating at 28°C overnight. Cells were harvested by centrifugation, washed three times with double-distilled water and used for extraction of total lipids.
The BODIPY505/515 (4,4-difluoro-1,3,5,7-tetramethyl-4-bora-3a,4a-diaza-s-indacene) (Invitrogen, USA) staining method described by Mou et al. (2012) was used to visualize the intracellular lipid bodies as an indicator of TAG formation. The yeast cells in the culture medium was stained with 2 μmol/L BODIPY 505/515 within 1 min at room temperature, and then immediately observed by fluorescence microscopy (Nikon Eclipse 80i, Japan). A filter allowing maximum excitation at 450–490 nm was used to stimulate the stained the yeast cells.
To extract total lipids from yeast, harvested cell pellets were lyophilized, ground with a mortar and then incubated in 7 mL methanol/chloroform (2:1, v/v) at 50°C for 10 min. After transferring lipid extract to a fresh tube, re-extract tissue with 1.5 mL methanol/chloroform (2:1, v/v). This operation was repeated two times. Combined all of the lipid extracts, and then add 2.5 mL chloroform and 3 mL 1% NaCl. Transfer the organic phase (lower phase) to a fresh glass tube, dried them under N2 and then dissolved in hexane. TAGs were separated from total lipids by thin layer chromatography (TLC) using a solvent system of hexane:ether:acetic acid (70:30:1, v/v/v). Individual lipid spots were visualized by exposing the silica gel plates to primuline vapor. Total fatty acids were extracted and transmethylated with methanolic HCl from yeast cells according to Browse et al. (1986). All samples were analyzed using a 7890A/5975C gas chromatography (Agilent Technologies, California, USA) and high purity nitrogen was used as the carrier gas. Measurements were performed using peak height area integrals expressed as a percentage of the total of all integrals. The experiment was carried out in triplicate, and the data subjected to analysis of variance using DPS software (Zhejiang University, China) Version 7.05. Duncan’s multiple range test was employed to determine the statistical significance (p<0.05) of the differences between the means.
Only one acyl-CoA: diacylglycerol acyltransferase-encoding gene was found in the U. prolifera transcriptome which was designated UpDGAT1 (Fig. 1). The open reading frame was 1 653-bp long, encoding a protein of 551 amino acids with a predicted molecular weight of 62.1 kDa and an isoelectric point of 8.85. Its amino acid sequence exhibited pairwise distance of 0.16 with DGAT1 from U. mutabilis (UM011_0232.1), but 0.71 and 0.89 with DGAT1 from C. variabilis (XP_005842809.1) and A. thaliana (AEC06882.1) respectively. This result indicates a deep evolutionary history of DGAT1-encoding genes. Analysis using TMpred software suggested that UpDGAT1 has nine transmembrane domains, located in the region of amino acids 93–111, 142–163, 194–216, 229–248, 333–351, 382–401, 439–463, 476–495, and 506–528, respectively.
Multiple sequence alignment showed that UpDGAT1 contains seven conserved motifs, namely Motif 1 (GL Block), Motif 2 (KSR Block), Motif 3 (PTR Block), Motif 4 (QP Block), Motif 5 (LWLFFEFDRFYWWNWWNPPFSHP Block), Motif 6 (FQL Block), and Motif 7 (NGQPY Block). These motifs are characteristic sequences in DGAT1s (Cao et al., 2011). Meanwhile, UpDGAT1 has a YYHD box in Motif 7, a putative ER retrieval motif, suggesting probable ER localization of the protein (Fig. 2).
To verify whether UpDGAT1 indeed encodes a protein with DGAT activity, the putative U. prolifera DGAT1 gene was expressed in a TAG-deficient S. cerevisiae quadruple mutant strain (H1246) (Burgal et al., 2008). INVSc1 was used as a positive control, and the empty vector pYES2 was transformed into the mutant strain as a negative control. Following expression, total lipids were extracted from the yeast cells in late stationary phase. Thin-layer chromatography (TLC) analysis of total lipids showed a prominent spot corresponding to TAG accumulation upon expression of UpDGAT1, whereas no TAG was detected in the quadruple mutant strain carrying the empty expression vector (Fig. 3).
In yeast cells, storage lipids, in the form of TAGs and steryl esters in lipid bodies, can be visualized using the fluorescent dye BODIPY505/515. To visualize the lipid bodies generated by the expression of UpDGAT1, yeast transformants were stained with BODIPY505/515 (Fig. 4). We found that lipid bodies were abundant in the wild-type and the mutant strain transformed with UpDGAT1, whereas they were absent from the mutant transformed with empty vector (pYES2). This result suggests that expression of UpDGAT1 in the yeast quadruple mutant strain can completely restore its ability to form lipid bodies through interaction with the yeast lipid synthesis pathway, which is consistent with the TLC results (Fig. 3).
We investigated whether expression of UpDGAT1 had any effect on the fatty acid composition of cellular lipids in S. cerevisiae. The expression of UpDGAT1 in the quadruple S. cerevisiae mutant resulted in a differential fatty acid composition of lipids compared with the mutant strain or the strain transformed with empty vector (pYES2) (Fig. 5). Fatty acids C16:1 and C18:0 decreased by 62.3% and 64.6% respectively, compared with the non-transgenic control strain. Expression of UpDGAT1 in the quadruple mutant led to a more than 1.2- and 1.05-fold increase in C16:0 and C18:1 compared with the control, respectively. There was a low proportion of C17:1 and C18:2 in the quadruple mutant, and their proportions in the lipids of UpDGAT1 transgenic yeast were increased 1.7-fold and 14-fold respectively. These results suggest that expression of UpDGAT1 in yeast can increase the incorporation and transfer of endogenous unsaturated fatty acids into lipids.
Another method to confirm the identity of putative TAG biosynthesis enzymes is to monitor their expression patterns to see if gene expression is correlated with increased TAG productivity in algae in certain growth conditions. To understand the relationship between UpDGAT1 expression and lipid synthesis, we investigated the expression pattern of UpDGAT1 and the TAG content of U. prolifera in different stress conditions (Fig. 6). Increased light intensity and salinity significantly down-regulated the expression of UpDGAT1, by 22.5- and 45.2-fold respectively. On the contrary, increased temperature and decreased salinity significantly upregulated the expression of UpDGAT1, by 4.79- and 7.34-fold respectively. The TAG contents were accordingly increased by 2.65- and 2.69-fold in high temperature and low salt conditions, respectively (Fig. 6). This result suggests that expression of UpDGAT1 in U. prolifera was very sensitive to environmental stresses, and that the enzyme may play an important role in stress acclimation.
There are at least two major families of DGATs, named Type 1 and Type 2, both of which are membrane-bound. Type 1 and Type 2 DGATs do not share any significant amino acid sequence similarity, although both catalyze the same reaction. In animals, DGAT2 seems to be the more potent enzyme, with higher affinity for its substrates and higher rates of TAG accumulation compared with DGAT1 (Yen et al., 2008). In higher plants, the functional difference between the two DGAT isozymes is not as clear (Shockey et al., 2006). Moreover, there is clear evidence that there are spatial and temporal differences in DGAT expression patterns. In olive, DGAT1 seems to play a more prominent role in olive oil accumulation compared with DGAT2 (Banilas et al., 2011). In contrast, DGAT2 may play a more important role in oil production compared with DGAT1 in oleogenic seed crops such as the tung tree and castor oil plant, which contain unusual fatty acids (Kroon et al., 2006; Shockey et al., 2006). Further evidence for this divergence in functionality between plant DGAT1 and DGAT2 can be seen from differences in their biochemical characteristics (Li et al., 2010). In P. tricornutum, PtDGAT1 tends to incorporate saturated C16:0 and C18:0 fatty acids into TAGs, whereas PtDGAT2 has a preference for unsaturated fatty acids (Guihéneuf et al., 2011; Gong et al., 2013). In O. tauri and Chlamydomonas reinhardtii, DGAT2 exhibited broad substrate specificity, preferring long-chain acyl groups (Wagner et al., 2010; La Russa et al., 2012). In U. prolifera, UpDGAT1 showed broad substrate specificity, accepting saturated (C16:0) as well as mono- (C18:1, C17:1) and polyunsaturated (C18:2) acyl-CoAs as substrates. In addition, TAG formation in algae is dependent on environmental conditions, which also regulate carbon metabolism. In U. prolifera, we found that both the expression level of UpDGAT1 and the TAG content was increased in low salt and high temperature conditions. We suggest that U. prolifera modifies its carbon metabolism to energy storage pathways in these conditions compared with high salt and high light intensity conditions.
The roles of lipids in both abiotic and biotic stresses are mainly as intermediates of signal transduction pathways in plant which is of rising interest (Berkey et al., 2012; Hou et al., 2016; Zhao, 2015). In algae, however, environmental stresses are mostly binding to TAG accumulation in various microalgae in light of current environmental and energy supply concerns (Arora et al., 2018). Various stress factors, especially nutrient-starvation conditions are known in inducing an increased formation of TAG in microalgae, such as Coccomyxa subellipsoidea (Allen et al., 2015) and Chlorella (Goncalves et al., 2013). Except for the nutrient stress, many studies have reported that non-chemical based stresses lead to the formation of TAG in microalgae including unfavorable temperature, high salinity, light intensity and dehydration. For example, increased temperature results in the elevation of lipid content in the freshwater phytoflagellate Ochromonas danica (Aaronson, 1973), the marine alga Nannochloropsis salina (Boussiba et al., 1987) and Chlamydomonas (Hemme et al., 2014); high light intensity increases TAG content in such as marine Nannochloropsis oculata (Ma et al., 2016) and Thalassiosira pseudonana (Brown et al., 1996). Synthesis of TAG can also be induced by high salinity as seen in the green algae Dunaliella salina (Takagi et al., 2006) and Chlamydomonas (Siaut et al., 2011). Similar studies was limitied in macroalgae as most of them contain comparable low lipid contents. One result came from the red alga Tichocarpus crinitus whose TAG content was increased by high light intensity (Khotimchenko and Yakovleva, 2005). Besides as energy content, lipid could also participate in rapid response to stresses by the generation of numerous signalling lipids, such as the rapid releasing of inositol 1,4,5-trisphosphate (InsP3) and diacylglycerol in model unicellular alga Chlamydomonas under osmotic stress (Meijer et al., 2017). In macroalgae, lipid peroxidation was confirmed partcipated in both the short term rapid defense reactions and long term cascade reactions under abiotic stress in kelp (Cosse et al., 2007). In our study, two specific stress conditions, low salinity and high temperature, could increase the TAG contents in accrodance with the increased UpDGAT1 expression level, while high light intensity and high salinity have no obvious impact on TAG accumulation. These results indicated that there is an increased TAG requirement when U. prolifera under low salinity and high temperature than under high salinity and light intensity, at least under our experimental conditions. We proposed that these unique characters of U. prolifera comparing to the unicellular microalgae, especially the response to different salinity, may be related to its special coastal conditions. However, the exact function of the UpDGAT1 gene and TAG, as energy store or participating in signal transduction, in stress response and acclimation in U. prolifera need more experimental proofs.
  • The National Key Research and Development Program of China under contract No.2016YFC1402102; the Central Public-interest Scientific Institution Basal Research Fund, CAFS under contract Nos 2020TD19 and 2020TD27; the Major Scientific and Technological Innovation Project of Shandong Provincial Key Research and Development Program under contract 2019JZZY020706; the International Exchange and Cooperation in Agriculture, Ministry of Agriculture and Rural Affairs of China-Science, Technology and Innovation Cooperation in Aquaculture with Tropical Countries along the Belt and Road; China Agriculture Research System under contract No. CARS-50; the Taishan Scholars Funding and Talent Projects of Distinguished Scientific Scholars in Agriculture; the National Ten Thousand Youth Talents Plan of 2014 under contract No. W02070268.
Aaronson S. 1973. Effect of incubation temperature on the macromolecular and lipid content of the phytoflagellate Ochromonas danica. Journal of Phycology, 9(1): 111–113, doi: 10.1111/j.0022-3646.1973.00111.x
Allen J W, DiRusso C C, Black P N. 2015. Triacylglycerol synthesis during nitrogen stress involves the prokaryotic lipid synthesis pathway and acyl chain remodeling in the microalgae Coccomyxa subellipsoidea. Algal Research, 10: 110–120, doi: 10.1016/j.algal.2015.04.019
Andrianov V, Borisjuk N, Pogrebnyak N, et al. 2010. Tobacco as a production platform for biofuel: overexpression of Arabidopsis DGAT and LEC2 genes increases accumulation and shifts the composition of lipids in green biomass. Plant Biotechnology Journal, 8(3): 277–287, doi: 10.1111/j.1467-7652.2009.00458.x
Arora N, Pienkos P T, Pruthi V, et al. 2018. Leveraging algal omics to reveal potential targets for augmenting TAG accumulation. Biotechnology Advances, 36(4): 1274–1292, doi: 10.1016/j.biotechadv.2018.04.005
Banilas G, Karampelias M, Makariti I, et al. 2011. The olive DGAT2 gene is developmentally regulated and shares overlapping but distinct expression patterns with DGAT1. Journal of Experimental Botany, 62(2): 521–532, doi: 10.1093/jxb/erq286
Berkey R, Bendigeri D, Xiao S Y. 2012. Sphingolipids and plant defense/disease: the “death” connection and beyond. Frontiers in Plant Science, 3: 68
Boussiba S, Vonshak A, Cohen Z, et al. 1987. Lipid and biomass production by the halotolerant microalga Nannochloropsis salina. Biomass, 12(1): 37–47, doi: 10.1016/0144-4565(87)90006-0
Brodie J, Chan C X, De Clerck O, et al. 2017. The algal revolution. Trends in Plant Science, 22(8): 726–738, doi: 10.1016/j.tplants.2017.05.005
Brown M R, Dunstan G A, Norwood S J, et al. 1996. Effects of harvest stage and light on the biochemical composition of the diatom Thalassiosira pseudonana. Journal of Phycology, 32(1): 64–73, doi: 10.1111/j.0022-3646.1996.00064.x
Browse J, McCourt P J, Somerville C R. 1986. Fatty acid composition of leaf lipids determined after combined digestion and fatty acid methyl ester formation from fresh tissue. Analytical Biochemistry, 152(1): 141–145, doi: 10.1016/0003-2697(86)90132-6
Burgal J, Shockey J, Lu C F, et al. 2008. Metabolic engineering of hydroxy fatty acid production in plants: RcDGAT2 drives dramatic increases in ricinoleate levels in seed oil. Plant Biotechnology Journal, 6(8): 819–831, doi: 10.1111/j.1467-7652.2008.00361.x
Callow J A, Callow M E. 2006a. Biofilms. In: Fusetani N, Clare A S, eds. Antifouling Compounds. Berlin, Heidelberg: Springer, 141–169
Callow J A, Callow M E. 2006b. The Ulva spore adhesive system. In: Smith A M, Callow J A, eds. Biological Adhesives. Berlin, Heidelberg: Springer, 63–78
Cao Heping. 2011. Structure-function analysis of diacylglycerol acyltransferase sequences from 70 organisms. BMC Research Notes, 4: 249, doi: 10.1186/1756-0500-4-249
Chen J E, Smith A G. 2012. A look at diacylglycerol acyltransferases (DGATs) in algae. Journal of Biotechnology, 162(1): 28–39, doi: 10.1016/j.jbiotec.2012.05.009
Chen Xue, Snyder C L, Truksa M, et al. 2011. sn-Glycerol-3-phosphate acyltransferases in plants. Plant Signaling and Behavior, 6(11): 1695–1699, doi: 10.4161/psb.6.11.17777
Chen Chunxiu, Sun Zheng, Cao Haisheng, et al. 2015. Identification and characterization of three genes encoding acyl-CoA: diacylglycerol acyltransferase (DGAT) from the microalga Myrmecia incisa Reisigl. Algal Research, 12: 280–288, doi: 10.1016/j.algal.2015.09.007
Cosse A, Leblanc C, Potin P. 2007. Dynamic defense of marine macroalgae against pathogens: from early activated to gene-regulated responses. Advances in Botanical Research, 46: 221–266, doi: 10.1016/S0065-2296(07)46006-2
Dong Meitao, Zhang Xiaowen, Chi Xiaoyan, et al. 2012. The validity of a reference gene is highly dependent on the experimental conditions in green alga Ulva linza. Current Genetics, 58(1): 13–20, doi: 10.1007/s00294-011-0361-3
Goncalves E C, Johnson J V, Rathinasabapathi B. 2013. Conversion of membrane lipid acyl groups to triacylglycerol and formation of lipid bodies upon nitrogen starvation in biofuel green algae Chlorella UTEX29. Planta, 238(5): 895–906, doi: 10.1007/s00425-013-1946-5
Gong Yangmin, Zhang Junping, Guo Xiaojing, et al. 2013. Identification and characterization of PtDGAT2B, an acyltransferase of the DGAT2 acyl-coenzyme A: diacylglycerol acyltransferase family in the diatom Phaeodactylum tricornutum. FEBS letters, 587(5): 481–487, doi: 10.1016/j.febslet.2013.01.015
Guihéneuf F, Leu S, Zarka A, et al. 2011. Cloning and molecular characterization of a novel acyl-CoA: diacylglycerol acyltransferase 1-like gene (PtDGAT1) from the diatom Phaeodactylum tricornutum. The FEBS Journal, 278(19): 3651–3666, doi: 10.1111/j.1742-4658.2011.08284.x
Hemme D, Veyel D, Mühlhaus T, et al. 2014. Systems-wide analysis of acclimation responses to long-term heat stress and recovery in the photosynthetic model organism Chlamydomonas reinhardtii. The Plant Cell, 26: 4270–4297, doi: 10.1105/tpc.114.130997
Hou Quancan, Ufer G, Bartels D. 2016. Lipid signalling in plant responses to abiotic stress. Plant, Cell & Environment, 39(5): 1029–1048
Hu Qiang, Sommerfeld M, Jarvis E, et al. 2008. Microalgal triacylglycerols as feedstocks for biofuel production: perspectives and advances. Plant Journal, 54(4): 621–639, doi: 10.1111/j.1365-313X.2008.03492.x
Khotimchenko S V, Yakovleva I M. 2005. Lipid composition of the red alga Tichocarpus crinitus exposed to different levels of photon irradiance. Phytochemistry, 66(1): 73–79, doi: 10.1016/j.phytochem.2004.10.024
Kim H, Park J H, Kim D J, et al. 2016. Functional analysis of diacylglycerol acyltransferase1 genes from Camelina sativa and effects of CsDGAT1B overexpression on seed mass and storage oil content in C. sativa. Plant Biotechnology Reports, 10(3): 141–153, doi: 10.1007/s11816-016-0394-7
Kroon J T M, Wei Wenxue, Simon W J, et al. 2006. Identification and functional expression of a type 2 acyl-CoA: diacylglycerol acyltransferase (DGAT2) in developing castor bean seeds which has high homology to the major triglyceride biosynthetic enzyme of fungi and animals. Phytochemistry, 67(23): 2541–2549, doi: 10.1016/j.phytochem.2006.09.020
Kumar S, Stecher G, Tamura K. 2016. Mega7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution, 33(7): 1870–1874, doi: 10.1093/molbev/msw054
La Russa M, Bogen C, Uhmeyer A, et al. 2012. Functional analysis of three type-2 DGAT homologue genes for triacylglycerol production in the green microalga Chlamydomonas reinhardtii. Journal of Biotechnology, 162(1): 13–20, doi: 10.1016/j.jbiotec.2012.04.006
Li Dawei, Cen Shiying, Liu Yuhong, et al. 2016. A type 2 diacylglycerol acyltransferase accelerates the triacylglycerol biosynthesis in heterokont oleaginous microalga Nannochloropsis oceanica. Journal of Biotechnology, 229: 65–71, doi: 10.1016/j.jbiotec.2016.05.005
Li Runzhi, Yu Keshun, Hildebrand D F. 2010. DGAT1, DGAT2 and PDAT expression in seeds and other tissues of epoxy and hydroxy fatty acid accumulating plants. Lipids, 45(2): 145–157, doi: 10.1007/s11745-010-3385-4
Mao Xuemei, Wu Tao, Kou Yaping, et al. 2019. Characterization of type I and type II diacylglycerol acyltransferases from the emerging model alga Chlorella zofingiensis reveals their functional complementarity and engineering potential. Biotechnology for Biofuels, 12(1): 28, doi: 10.1186/s13068-019-1366-2
Ma Xiaonan, Liu Jin, Liu Bin, et al. 2016. Physiological and biochemical changes reveal stress-associated photosynthetic carbon partitioning into triacylglycerol in the oleaginous marine alga Nannochloropsis oculata. Algal Research, 16: 28–35, doi: 10.1016/j.algal.2016.03.005
Meijer H J G, van Himbergen J A J, Musgrave A, et al. 2017. Acclimation to salt modifies the activation of several osmotic stress-activated lipid signalling pathways in Chlamydomonas. Phytochemistry, 135: 64–72, doi: 10.1016/j.phytochem.2016.12.014
Miller R, Wu Guangxi, Deshpande R R, et al. 2010. Changes in transcript abundance in Chlamydomonas reinhardtii following nitrogen deprivation predict diversion of metabolism. Plant Physiology, 154: 1737–1752, doi: 10.1104/pp.110.165159
Misra A, Khan K, Niranjan A, et al. 2013. Over-expression of JcDGAT1 from Jatropha curcas increases seed oil levels and alters oil quality in transgenic Arabidopsis thaliana. Phytochemistry, 96: 37–45, doi: 10.1016/j.phytochem.2013.09.020
Mou Shanli, Xu Dong, Ye Naihao, et al. 2012. Rapid estimation of lipid content in an Antarctic ice alga (Chlamydomonas sp.) using the lipophilic fluorescent dye BODIPY505/515. Journal of Applied Phycology, 24(5): 1169–1176, doi: 10.1007/s10811-011-9746-4
Niu Yingfang, Zhang Minghan, Li Dawei, et al. 2013. Improvement of neutral lipid and polyunsaturated fatty acid biosynthesis by overexpressing a type 2 diacylglycerol acyltransferase in marine diatom Phaeodactylum tricornutum. Marine Drugs, 11(11): 4558–4569, doi: 10.3390/md11114558
Ohlrogge J, Browse J. 1995. Lipid biosynthesis. The Plant Cell, 7: 957–970
Rani S H, Krishna T H A, Saha S, et al. 2010. Defective in cuticular ridges (DCR) of Arabidopsis thaliana, a gene associated with surface cutin formation, encodes a soluble diacylglycerol acyltransferase. Journal of Biological Chemistry, 285: 38337–38347, doi: 10.1074/jbc.M110.133116
Roesler K, Shen Bo, Bermudez E, et al. 2016. An improved variant of soybean type 1 diacylglycerol acyltransferase increases the oil content and decreases the soluble carbohydrate content of soybeans. Plant Physiology, 171(2): 878–893
Savadi S, Naresh V, Kumar V, et al. 2016. Seed-specific overexpression of Arabidopsis DGAT1 in Indian mustard (Brassica juncea) increases seed oil content and seed weight. Botany, 94(3): 177–184, doi: 10.1139/cjb-2015-0218
Shockey J M, Gidda S K, Chapital D C, et al. 2006. Tung tree DGAT1 and DGAT2 have nonredundant functions in triacylglycerol biosynthesis and are localized to different subdomains of the endoplasmic reticulum. The Plant Cell, 18: 2294–2313, doi: 10.1105/tpc.106.043695
Siaut M, Cuiné S, Cagnon C, et al. 2011. Oil accumulation in the model green alga Chlamydomonas reinhardtii: characterization, variability between common laboratory strains and relationship with starch reserves. BMC Biotechnology, 11: 7, doi: 10.1186/1472-6750-11-7
Smetacek V, Zingone A. 2013. Green and golden seaweed tides on the rise. Nature, 504(7478): 84–88, doi: 10.1038/nature12860
Takagi M, Karseno, Yoshida T. 2006. Effect of salt concentration on intracellular accumulation of lipids and triacylglyceride in marine microalgae Dunaliella cells. Journal of Bioscience and Bioengineering, 101(3): 223–226, doi: 10.1263/jbb.101.223
Taylor D C, Zhang Yan, Kumar A, et al. 2009. Molecular modification of triacylglycerol accumulation by over-expression of DGAT1 to produce canola with increased seed oil content under field conditions. Botany, 87(6): 533–543, doi: 10.1139/B08-101
Úbeda-Mínguez P, García-Maroto F, Alonso D L, et al. 2017. Heterologous expression of DGAT genes in the marine microalga Tetraselmis chui leads to an increase in TAG content. Journal of Applied Phycology, 29(4): 1913–1926, doi: 10.1007/s10811-017-1103-9
Vesty E F, Kessler R W, Wichard T, et al. 2015. Regulation of gametogenesis and zoosporogenesis in Ulva linza (Chlorophyta): comparison with Ulva mutabilis and potential for laboratory culture. Frontiers in Plant Science, 6: 15
Wagner M, Hoppe K, Czabany T, et al. 2010. Identification and characterization of an acyl-CoA: diacylglycerol acyltransferase 2 (DGAT2) gene from the microalga O. tauri. Plant Physiology & Biochemistry, 48(6): 407–416
Wang Zhikun, Yang Mingming, Sun Yingnan, et al. 2019. Overexpressing Sesamum indicum L.’s DGAT1 increases the seed oil content of transgenic soybean. Molecular Breeding, 39(7): 101, doi: 10.1007/s11032-019-1016-1
Weselake R J, Shah S, Tang Mingguo, et al. 2008. Metabolic control analysis is helpful for informed genetic manipulation of oilseed rape (Brassica napus) to increase seed oil content. Journal of Experimental Botany, 59(13): 3543–3549, doi: 10.1093/jxb/ern206
Xu Jingyu, Francis T, Mietkiewska E, et al. 2008. Cloning and characterization of an acyl-CoA-dependent diacylglycerol acyltransferase 1 (DGAT1) gene from Tropaeolum majus, and a study of the functional motifs of the DGAT protein using site-directed mutagenesis to modify enzyme activity and oil content. Plant Biotechnology Journal, 6(8): 799–818, doi: 10.1111/j.1467-7652.2008.00358.x
Yen C L E, Stone S J, Koliwad S, et al. 2008. Thematic review series: glycerolipids. DGAT enzymes and triacylglycerol biosynthesis. Journal of Lipid Research, 49: 2283–2301, doi: 10.1194/jlr.R800018-JLR200
Zhang Yongyu, He Peimin, Li Hongmei, et al. 2019. Ulva prolifera green-tide outbreaks and their environmental impact in the Yellow Sea, China. National Science Review, 6(4): 825–838, doi: 10.1093/nsr/nwz026
Zhao Jian. 2015. Phospholipase D and phosphatidic acid in plant defence response: from protein-protein and lipid-protein interactions to hormone signalling. Journal of Experimental Botany, 66(7): 1721–1736, doi: 10.1093/jxb/eru540
Zheng Peizhong, Allen W B, Roesler K, et al. 2008. A phenylalanine in DGAT is a key determinant of oil content and composition in maize. Nature Genetics, 40(3): 367–372, doi: 10.1038/ng.85
Year 2020 volume 39 Issue 10
PDF
174
110
Cite this Article
BibTeX
Article Info
doi: 10.1007/s13131-020-1659-0
  • Receive Date:2019-11-01
  • Online Date:2026-03-31
  • Published:2020-10-25
Article Data
Affiliations
History
  • Received:2019-11-01
  • Accepted:2020-04-20
Funding
The National Key Research and Development Program of China under contract No.2016YFC1402102; the Central Public-interest Scientific Institution Basal Research Fund, CAFS under contract Nos 2020TD19 and 2020TD27; the Major Scientific and Technological Innovation Project of Shandong Provincial Key Research and Development Program under contract 2019JZZY020706; the International Exchange and Cooperation in Agriculture, Ministry of Agriculture and Rural Affairs of China-Science, Technology and Innovation Cooperation in Aquaculture with Tropical Countries along the Belt and Road; China Agriculture Research System under contract No. CARS-50; the Taishan Scholars Funding and Talent Projects of Distinguished Scientific Scholars in Agriculture; the National Ten Thousand Youth Talents Plan of 2014 under contract No. W02070268.
Affiliations
    1 Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China
    2 Function Laboratory for Marine Fisheries Science and Food Production Processes, Pilot National Laboratory for Marine Science and Technology (Qingdao), Qingdao 266237, China
    3 Shandong Peanut Research Institute, Qingdao 266100, China
    4 College of Marine Science and Biological Engineering, Qingdao University of Science and Technology, Qingdao 266042, China

Corresponding:

References
Share
https://castjournals.cast.org.cn/joweb/aos/EN/10.1007/s13131-020-1659-0
Share to
QR

Scan QR to access full text

Cite this article
BibTeX
Citations
表12种不同金属材料的力学参数

Family
属数
Number of
genus
种数
Number of
species
占总种数比例
Percentage of
total species (%)

Genus
种数
Number of
species
占总种数比例
Percentage of total
species (%)
鹅膏菌科Amanitaceae 2 11 5.26 鹅膏菌属 Amanita 10 4.78
小菇科 Mycenaceae 2 12 5.74 丝盖伞属 Inocybe 5 2.39
多孔菌科 Polyporaceae 8 14 6.70 蜡蘑属 Laccaria 5 2.39
红菇科 Russulaceae 3 23 11.00 小皮伞属 Marasmius 6 2.87
小菇属 Mycena 11 5.26
光柄菇属 Pluteus 5 2.39
红菇属 Russula 17 8.13
栓菌属 Trametes 5 2.39
关闭全屏
  • BibTeX
  • EndNote
  • RefWorks
  • TxT