Dietary supplementation with 25-hydroxyvitamin D<sub>3</sub> regulates productive performance, lipid metabolism and gut microbiota in aged laying ducks

Dietary supplementation with 25-hydroxyvitamin D₃ regulates productive performance, lipid metabolism and gut microbiota in aged laying ducks

PDF

Yongyan Jin, Huanting Xia, Wei Chen, Xuebing Huang, Kaichao Li, Shuang Wang, Weiguan Xia, Shenglin Wang, Chang Zhang, Yanan Zhang^*, Chuntian Zheng^*

Animal Nutrition | 2024, 19(1) : 90 - 103

Less

Animal Nutrition | 2024, 19(1): 90-103

• Original Research Article •

Dietary supplementation with 25-hydroxyvitamin D₃ regulates productive performance, lipid metabolism and gut microbiota in aged laying ducks

Full

Yongyan Jin, Huanting Xia, Wei Chen, Xuebing Huang, Kaichao Li, Shuang Wang, Weiguan Xia, Shenglin Wang, Chang Zhang, Yanan Zhang^*, Chuntian Zheng^*

Affiliations

Key Laboratory of Animal Nutrition and Feed Science in South China, Ministry of Agriculture and Rural Affairs, State Key Laboratory of Swine and Poultry Breeding Industry, Guangdong Public Laboratory of Animal Breeding and Nutrition, Guangdong Provincial Key Laboratory of Animal Breeding and Nutrition, Institute of Animal Science, Guangdong Academy of Agricultural Sciences, Guangzhou 510640, China

Published: 2024-12-10 doi: 10.1016/j.aninu.2024.04.029

Outline

Abstract

Less

The aim of this study was to investigate the effect of dietary supplementation with 25-hydroxyvitamin D₃ (25(OH)D₃) on productive performance, lipid metabolism and gut microbiota in aged laying ducks. A total of 432 healthy Longyan ducks at 60-week of age were randomly allotted to 6 groups, each with 6 replicates of 12 ducks. Ducks were given a basal diet (without added 25(OH)D₃) or that diet supplemented with 800, 1600, 2400, 3200, or 4000 IU/kg 25(OH)D₃ for a total of 16 wk. Dietary supplementation with 25(OH)D₃ improved egg production, egg mass and average daily feed intake, and decreased the feed conversion ratio (FCR) of ducks during the whole trial period (linear, quadratic; P < 0.05). Supplementation with 25(OH)D₃ decreased very low-density lipoprotein (VLDL) content in yolk (P = 0.008), decreased high-density lipoprotein and low-density lipoprotein (LDL) content in plasma (P = 0.002). Hepatic index, VLDL, LDL, triglyceride and total cholesterol content in liver, nonalcoholic fatty liver activity score of liver and alanine aminotransferase activity in plasma were decreased with supplementation of 25(OH)D₃ (linear or quadratic; P < 0.05). The decreased hepatic apolipoprotein B 100 and lipoprotein lipase expression, and increased hepatic peroxisome proliferator-activated receptor-α and sterol regulatory element binding protein-1 expression resulted from 25(OH)D₃ supplementation (linear, quadratic; P < 0.05). Moreover, 25(OH)D₃ supplementation increased the villus/crypt ratio (linear, quadratic; P < 0.05) and expression of zonula occludens protein 1 and nuclear factor-κ-gene binding in duodenum (P < 0.05). The supplementation of 25(OH)D₃ reduced the abundance of Wittenberg polluted soil-2 bacteria, Synergistota, Bacteroidales, Colidextribacter, Eggerthellaceae, Oscillospira, Oscillibacter, UCG-009, Barnesiellaceae and Lachnospiraceae_UCG-010 in cecal contents (P < 0.05). Dietary requirements for 25(OH)D₃ for ducks (60 to 76 wk), were estimated to be 3377 IU/kg for egg production, 3434 IU/kg for egg mass, and 3256 IU/kg for FCR. In summary, dietary 25(OH)D₃ supplementation improved productive performance and influenced liver and plasma lipid homeostasis in aged laying ducks, which may be associated with the reduction of bacteria involved in carbohydrate metabolism in the cecum. Supplementing the basal diet with 3250 to 3450 IU/kg 25(OH)D₃ is recommended for aged laying ducks (60 to 76 wk).

Key words

Laying duck / 25-Hydroxyvitamin D₃ / Lipid metabolism / Cecal microbiota

Cite this Article

Yongyan Jin, Huanting Xia, Wei Chen, Xuebing Huang, Kaichao Li, Shuang Wang, Weiguan Xia, Shenglin Wang, Chang Zhang, Yanan Zhang, Chuntian Zheng. Dietary supplementation with 25-hydroxyvitamin D₃ regulates productive performance, lipid metabolism and gut microbiota in aged laying ducks[J]. Animal Nutrition, 2024 , 19 (1) : 90 -103 . DOI: 10.1016/j.aninu.2024.04.029

Full Text

Less

1.　Introduction

Less

Aged commercial laying poultry are known for their decreased productive performance after the long peak-laying period, leading to limited economic profit (England and Ruhnke, 2020; Van Den Brand et al., 2004). This is partly because of the disturbance in the lipid metabolism, which can result in the lipid droplet deposition in liver (Trott et al., 2014), affecting hepatic function. In aged laying hens, fatty liver hemorrhagic syndrome impairs the ability of the liver to synthesize yolk precursors, which reduces egg production and egg quality (Tůmová et al., 2017). In addition, impaired intestinal function with aging also contributes to decreased performance of aged laying hens (Rattanawut et al., 2018; Wistedt et al., 2019). Transcriptome analysis found that the homeostasis of lipid metabolism and antioxidant status in the intestine in aged laying hens was impaired compared with the young hens (Wang et al., 2019). Compared with hens at the late laying period, the population of Bacteroides in the cecal microbiome was enriched, and the pathway of carbohydrate biosynthesis and metabolism was enhanced in cecal contents in laying hens at the peak laying period; these might provide more energy to the hens and lead to higher levels of egg production (Yang et al., 2022). In this respect, several studies have focused on regulating lipid metabolism and gut health in aged birds (Han et al., 2023; W.W. Wang et al., 2020).

Vitamin D₃ is an essential nutrient influencing bone health and the dynamic balance of calcium and phosphorus, and improving eggshell quality in laying hens (Chen et al., 2020; Sinclair-Black et al., 2023). Dos Santos et al. (2021) found that dietary supplementation 25(OH)D₃ increased eggshell thickness in aged layers. Recent studies have discovered that vitamin D₃ played a pivotal role in lipid metabolism and intestinal homeostasis in vivo or in vitro (Lee et al., 2020; Fakhoury et al., 2020). The primary form of vitamin D₃ that circulates in the blood is 25-hydroxyvitamin D₃ (25(OH)D₃), which is of hepatic origin (Soares et al., 1995). It is one of the best markers of the vitamin D₃ status in animals (Bar et al., 2003). The commercial product, 25 (OH)D₃, has gained approval as a feed additive for animals, and shows better biological activity than vitamin D₃ in laying hens (J. Wang et al., 2020, 2021). It has been demonstrated that 25(OH)D₃ was more easily utilized than vitamin D₃ in birds (Bar et al., 1980). Dietary 25(OH)D₃ supplementation improved gut morphology in growing chickens (Chou et al., 2009) and intestinal barrier function in hens (Wang et al., 2023). In addition, 25(OH)D₃ played an anti-injury role in intestinal barrier function and affected colonization and composition of intestinal microbes (Zhang and Piao, 2021). Vitamin D influenced the gut microbiome, and its deficiency resulted in dysbiosis by increasing the abundance of Bacteroidetes and Proteobacteria phyla, leading to greater susceptibility to injury in the guts of mice (Ooi et al., 2013). Several studies have observed a correlation between vitamin D₃ and lipid metabolism. Vitamin D plays a role in reducing lipid accumulation and inhibiting fat formation in 3T3-L1 preadipocytes (Rayalam et al., 2008). It has been observed that the absence of adipose tissue-specific vitamin D receptor in female mice can lead to an increase in visceral fat mass (Matthews et al., 2016). The expression of lipogenic genes, such as fatty acid synthase (FAS), acetyl-CoA carboxylase 1 (ACC1), and sterol regulatory element-binding protein-1c (SREBP-1c), was suppressed by dietary 1,25-dihydroxyvitamin D₃ supplementation in rats (Kang et al., 2015). 1,25-Dihydroxyvitamin D₃ suppressed biosynthesis of fat in preadipocytes and mesenchymal stem cells from mice, swine and humans through multiple targets including peroxisome proliferator-activated receptor-γ (PPAR-γ) (Mutt et al., 2014; Li et al., 2018).

A number of studies have indicated that laying performance, egg and bone quality, were optimized by inclusion of 1500 to 3300 IU/kg 25(OH)D₃ in diets for laying hens (Chen et al., 2020; Terry et al., 1999; Koreleski and Świątkiewicz, 2005). Given the lack of research on 25(OH)D₃ in laying ducks, the equivalent recommendation for such birds is lacking. Overall, the current research was aimed at studying the effect of dietary 25(OH)D₃ supplementation on productive performance, egg quality, lipid metabolism, gut morphology and microflora composition in aged laying ducks, to recommend a suitable supplemental level of 25(OH)D₃ for use in the laying duck industry.

2.　Materials and methods

Less

2.1.　 Animal ethics statement

The animal experimental protocol used in this study was based on the Chinese guidelines for animal welfare and was approved by the Animal Care and Use Committee of Guangdong Academy of Agricultural Sciences (2023006).

2.2.　 Diets and study design

A total of 432 healthy Longyan ducks at 60-wks were randomly allotted to 6 groups, each with 6 replicates of 12 ducks. The trial lasted for 16 wk. Ducks were fed a basal diet without 25(OH)D₃ supplementation or supplementation with 25(OH)D₃ (250 mg/kg; DSM, Heerlen, Netherlands) at 800, 1600, 2400, 3200, or 4000 IU/kg (1 IU = 0.025 μg). Each duck was raised in a cage equipped with a feeder and a nipple water dispenser. Diets and water were supplied ad libitum. The composition and nutrient levels of the basal diet are listed in Table 1. It was formulated according to the China National Standard (GB/T 41189-2021). The content of crude protein in the diet was determined by using the Kjeldahl method (GB/T 6432-2018). The contents of calcium and total phosphorus in the diet were determined by ethylenediaminetetraacetic acid complexometric titration (GB/T 6436-2018) and ammonium metavanadate colorimetric (GB/T 6437-2018) method, respectively.

2.3.　 Sample collection

At the end of wk 4, 8, 12, and 16 of the trial periods, 3 eggs approximating the average egg weight for each replicate were randomly selected to measure egg quality. The measurements were completed on the day of collection.

At the end of trial, 2 ducks from each replicate were selected according to average body weight. After fasting for 12 h, blood (5 mL each tube, 2 tubes each duck) was obtained from the wing vein into evacuated tubes, containing heparin sodium, and centrifuged at 3000 × g for 10 min, and the plasma was collected and kept at −80℃ until analysis.

These ducks were then killed by cervical dislocation and exsanguination. The liver was immediately excised and weighed. The liver tissue sample (1 cm × 1 cm × 1 cm) was taken from the mid-right section and fixed in formaldehyde. A sample of middle liver was put into a 1.5-mL sterile tube, and the remaining liver tissue was wrapped in aluminum foil, and then immediately frozen in liquid nitrogen and stored at −80℃ until analysis. A segment (1 cm) was excised from the mid-duodenum and fixed in formaldehyde. The lumen would be rinsed with saline and a segment would be opened lengthwise for the mucosa to be removed by gentle scraping, before being transferred into nuclease-free tubes. These tubes were immediately placed into liquefied nitrogen and kept in the refrigerator at −80℃ until analysis. Similarly, the contents of the cecum were also scraped into an enzyme-free tube and immediately placed in liquid nitrogen, and then stored at −80℃ refrigerator until analysis.

2.4.　 Performance and egg quality

The number and weight of eggs and broken eggs, and the feed consumption were recorded daily. Egg production, average egg weight, egg mass, average daily feed intake, feed conversion ratio (FCR), and ratio of broken eggs were calculated every 4 wk.

An electronic analytical balance was used to measure egg, yolk and albumen weight, then the albumen and yolk ratio was calculated. The albumen height, yolk color, and Haugh unit were measured with an Egg Analyzer (Israel Orka Food Technology Ltd., Herzliya, Israel).

2.5.　 Lipid metabolism indices in plasma, liver and yolk

The indices of lipid metabolism included triglycerides (TG), high density lipoprotein (HDL), low density lipoprotein (LDL), very low-density lipoprotein (VLDL), insulin (INS), lipase (LPS), total cholesterol (TC), aspartate transaminase (AST) and alanine aminotransferase (ALT) in plasma, liver and yolk, and were analyzed by biochemical kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). Plasma concentrations of follicle stimulating hormone (FSH), luteinizing hormone (LH), and estradiol (E₂) were measured by ELISA kits for ducks (Shanghai Enzyme-linked Biotechnology Co., Ltd., Shanghai, China).

2.6.　 Liver fat content

Crude fat content in liver was determined using Soxhlet extraction with diethyl ether. The liver tissues stored at −80℃ were thawed at room temperature, oven-dried at 105℃ to constant mass; defatted filter paper was dried the same way. The dried liver was ground and a sample of approximately 2 g was weighed precisely (±100 g), wrapped in filter paper and re-dried, as above. After Soxhlet extraction (Soxtec-2055, FOSS, Hilleroed, Denmark) with anhydrous diethyl ether, the remaining tissue and filter was dried, as before, and weighed. Hepatic fat was expressed relative to dry tissue weight as percentages.

2.7.　 Liver and duodenum histology

Hepatic and duodenal tissues fixed in formalin were dehydrated, embedded in paraffin wax, sectioned at 4 μm thickness, dewaxed, rehydrated and then stained with sodium fluorescein (NaFl) dye, which consists of the degree of steatosis, ballooning, and lobular inflammation, scored using the published scoring system (Kleiner et al., 2005). 3DHistech software (3DHistech Ltd., Budapest, Hungary) was used for morphological examination of duodenal samples. Villus height was measured from the tip of the villus to the villus–crypt junction, and crypt depth was defined as the depth of the invagination between two villi (Saadatmand et al., 2019). Villus height to crypt depth ratio was then calculated.

2.8.　 Expression of key genes involved in lipid metabolism and the intestinal barrier

Total RNA was extracted from tissue samples using the Trizol procedure, giving product of OD260/280 (from 1.8 to 2.0) for reverse transcription (Aikerui Bioengineering Co., Ltd., Hunan, China) to generate cDNA. Relative expression was determined by real-time fluorescence quantitative PCR (Bio-Rad CFX96, Hercules, CA) with primers (Table 2) prepared by Shenggong Bioengineering Co., Ltd. (Shanghai, China). Relative quantification used the 2^−ΔΔCt approach (Livak and Schmittgen, 2001) with β-actin used as the reference transcript.

2.9.　 Cecal microflora determination by 16S rRNA

The composition of the duck cecal microbiome was determined by 16S rRNA sequencing, performed by Meiji Biotechnology Co., Ltd. (Shanghai, China). After DNA extraction was complete, the quality of the extracted DNA was checked using 1% agarose gel electrophoresis. PCR amplification was performed with the TransStart FastPfu DNA Polymerase (Transgen Biotech, Beijing, China) and each sample was repeated three times. The amplified products from the same sample were mixed and electrophoresis was performed with 2% agarose gel for detection. Based on the preliminary electrophoresis quantification results, the QuantiFluor™-ST blue fluorescence quantification system (Promega Corporation, Wisconsin, USA) was used to detect and quantify the PCR products, and the products were mixed at an appropriate ratio according to the sequencing requirements of each sample. The Illumina library was constructed and sequenced according to the sequencing quantity requirements of each sample. Paired-end reads from Illumina sequencing were first combined based on overlap, while sequence quality was controlled and filtered. After identifying the samples, operational taxonomic unit (OTU) cluster analysis and species classification analysis were both performed. Based on the OTU, multiple diversity analysis and sequencing depth detection were performed. Based on taxonomic information, a statistical analysis of community structure at various levels was estimated.

2.10.　 Statistical analysis

Each replicate was taken as the experimental unit. Homogeneity of variance of the data was confirmed using the Explore tool of SPSS 22.0 software (IBM Corporation, Armonk, NY, USA). To assess the impact of dietary 25(OH)D₃ supplementation, one-way ANOVA was employed, then means were compared using Tukey's multiple range tests. Regression analysis was employed to test the linear (L) and quadratic (Q) effects using SPSS 22.0 software.

The formula (Y = aX² + bX + c) is used to estimate the recommended supplemental level of 25 (OH)D₃, given by the lowest level resulting in 95% of the maximal response. The microbiome analysis was carried out using the Majorbio Cloud platform (Shanghai, China; https://cloud.majorbio.com). Data are expressed as means and pooled SEM. P < 0.05 was considered to be significant. The software Origin 2021 (OriginLab, Northampton, UK) was used for figures.

3.　Results

Less

3.1.　 Productive performance

Dietary 25(OH)D₃ supplementation improved egg production, egg mass, and average daily feed intake (P < 0.05, Table 3), and the responses were linear and quadratic with increasing levels during the trial period (5 to 8 wk, 9 to 12 wk, 13 to 16 wk and 1 to 16 wk, P < 0.05). The FCR was decreased with dietary 25(OH)D₃ supplementation during the whole duration (P < 0.001), and there were linear and quadratic effects between them (P < 0.05). There were no differences among treatments in the ratio of broken eggs (P = 0.692). Compared with the control, diets supplemented with 25(OH)D₃ at 2400 to 4000 IU/kg increased egg production, egg mass and feed intake, and decreased FCR during the whole trial period (P < 0.05).

3.2.　 Egg quality

Dietary supplementation of 25(OH)D₃ decreased weight and ratio of yolk, and increased the albumen ratio at wk 12, 16 and the mean value for the total trial period (P < 0.05, Table 4), and the responses were quadratic (P < 0.05). At wk 12, albumen weight was increased with supplementation of 25(OH)D₃ (P = 0.027), and there was a quadratic effect of increasing dose (P = 0.004). Egg weight, albumen height, yolk color, and Haugh unit were not affected by dietary 25(OH)D₃ supplementation (P > 0.05). Compared with the control, decreased yolk weight and ratio resulted from supplementation with 800 IU/kg 25(OH)D₃, while albumen ratio was increased by 1600 IU/kg 25(OH)D₃ (P < 0.05).

3.3.　 Lipid metabolism

Dietary supplementation with 25(OH)D₃ affected the contents of TC, HDL, LDL and FSH in plasma of laying ducks (P < 0.05, Table 5). There was a quadratic effect between level of 25(OH)D₃ supplementation and TC content (P < 0.001) with the lowest value obtained with 2400 IU/kg. The contents of HDL and LDL decreased linearly and quadratically with increasing dietary 25(OH)D₃ levels (P < 0.05). Plasma concentration of FSH increased linearly and quadratically with dietary 25(OH)D₃ supplementation (P < 0.05). There were no significant changes to TG, VLDL, E₂ and LH in plasma with supplementation of 25(OH)D₃ (P > 0.05). Compared with the control, diets supplemented with 2400 and 3200 IU/kg 25(OH)D₃ had decreased LDL, HDL and INS contents, and increased FSH content in plasma (P < 0.05).

Dietary supplementation of 25(OH)D₃ affected the liver index and its lipase activity, along with hepatic contents of TG, TC, HDL, LDL and VLDL in laying ducks (P < 0.05, Table 5). The liver index and its VLDL content were linearly decreased (P = 0.029) and the contents of TG, TC and LDL in liver were linearly and quadratically decreased with increasing 25(OH)D₃ supplemental levels (P < 0.05). The responses of lipase activity and HDL contents were quadratic with 25(OH)D₃ supplementation in diets (P < 0.05). Remarkably, the lowest values of TG, TC, HDL, LDL and VLDL contents in laying ducks were observed with supplementation of 25(OH)D₃ at 2400 IU/kg. Supplementation with 25(OH)D₃ did not affect body weight, liver weight and liver EE content in laying ducks (P > 0.05). Dietary 25(OH)D₃ at 2400 and 3200 IU/kg increased LPS content, and decreased TG, TC and LDL content in liver (P < 0.05). The HDL content was increased with 4000 IU/kg, but decreased with 2400 IU/kg supplementation (P < 0.001).

The VLDL content in egg yolk decreased with increasing supplementation of 25(OH)D₃ (P = 0.008, Table 5), with linear and quadratic effects (P < 0.05) and lower values were observed with 3200 and 4000 IU/kg supplementation (P < 0.05). Dietary 25(OH)D₃ supplementation affected the TG content in egg yolk (P < 0.001); responses were linear and quadratic (P < 0.05), and values with 4000 IU/kg exceeded all other treatments (P < 0.05). There was no difference of TC content in egg yolk with the dietary supplementation of 25(OH)D₃ (P = 0.497).

3.4.　 Liver morphology and key indices of function in plasma

As shown in Fig. 1, dietary 25(OH)D₃ supplementation decreased the nonalcoholic fatty liver disease activity score (NAS) of liver and ALT content in plasma (P < 0.05). Compared with ducks fed the basal diet, lower NAS and ALT activity in plasma was observed with 2400 and 3200 IU/kg supplementation, respectively (P < 0.05). The AST activity in plasma was not affected by 25(OH)D₃ supplementation (P = 0.757).

3.5.　 Gene expression in the ovarian follicle and liver

As shown in Fig. 2A, the expression of ovarian very low-density lipoprotein receptor (OVR) gene in ovarian follicle was decreased with increasing supplementation of 25(OH)D₃ (P < 0.001), and responses were linear and quadratic (P < 0.05).

Dietary 25(OH)D₃ supplementation affected the hepatic expression of apolipoprotein B 100 (ApoB100), lipoprotein lipase (LPL), peroxisome proliferator-activated receptor-α (PPARα), liver X receptor (LXR), sterol regulatory element binding protein-1 (SREBP1) and apolipoprotein very low-density lipoprotein-II (apoVLDL-II) genes (Fig. 2B–J, P < 0.05). The mRNA abundance of ApoB100 (quadratic, P < 0.001) and LPL (linear, quadratic; P < 0.05) decreased; while those of PPARα (linear, quadratic; P < 0.05) and SREBP1 (linear, quadratic; P < 0.05) increased with increasing 25(OH)D₃ supplementation levels. The response of LXR transcripts was linear and quadratic with 25(OH)D₃ supplementation with lower values in 2400 and 3200 IU/kg treatments (P < 0.001). There was a quadratic effect between level of supplemental 25(OH)D₃ and apoVLDL-II transcript levels with lowest values were observed with 1600 and 2400 IU/kg supplementation (P < 0.001). Dietary supplementation of 25(OH)D₃ did not affect hepatic gene expression of ACC, FAS and INSR (P > 0.05). Compared with the control, dietary 25(OH)D₃ supplemental levels at 1600 to 4000 IU/kg increased hepatic transcripts of PPARα and SREBP1, and decreased those of ApoB100 and LPL (P < 0.05).

3.6.　 Duodenal morphology and gene expression

Dietary supplementation of 25(OH)D₃ decreased duodenal crypt depth (P = 0.006) and increased the villus to crypt ratio (Fig. 3, P = 0.020), and the responses were linear and quadratic (P < 0.05). Lower values of crypt depth and higher values of villus to crypt ratio were observed in ducks fed 2400 and 3200 IU/kg 25(OH)D₃ compared with ducks fed the basal diet (P < 0.05). Transcripts of zonula occludens protein 1 (ZO-1) and nuclear factor-κ-gene binding (NF-κB) in duodenum of laying ducks were higher than in controls with 3200 and 800 IU/kg 25(OH)D₃ supplementation, respectively (P < 0.05). There was no impact of dietary 25(OH)D₃ supplementation on duodenal gene expression of tumor necrosis factor-α (P = 0.359).

3.7.　 Change of cecal microflora

Fig. 4A presents the results of OTU partition of cecal microorganisms in laying ducks. There was 951 common OTU. The controls acquired unique 11 OTU, whereas 21, 34, 11, 14 and 35 OTU were uniquely acquired from ducks supplemented with 800, 1600, 2400, 3200 and 4000 IU/kg of 25(OH)D₃, respectively. The number of OTUs decreased with the number of samples they show up (Fig. 4C), which indicated that the sample size in this study was sufficient. As shown in Fig. 4B, at the phylum level, there were mainly Firmicutes and Bacteroidetes in the cecal microorganisms in laying ducks, regardless of 25(OH)D₃ supplementation. The results of the beta diversity analysis are shown in Fig. 4D. The distance among the treatments was close, indicating that the addition of dietary 25(OH)D₃ had no effect on the beta diversity of cecal microflora in laying ducks (P = 0.582). Fig. 4E shows the number of OTUs and alpha diversity indexes including Shannon, abundance-based coverage estimator (ACE), Simpson and Chao1 indexes of cecal microorganisms in laying ducks. The results showed that dietary 25(OH)D₃ supplementation had no effect on the number of OTUs and alpha diversity of the cecal microflora (P > 0.05). Fig. 5A–E shows the differences in microbial composition between the controls and 25(OH)D₃ treatments in the phylum, class, order, family and genus levels, respectively. Dietary supplementation of 25(OH)D₃ decreased the cecal abundance of Wittenberg polluted soil-2 bacteria (WPS-2) and Synergistaceae at phylum, class and order levels (P < 0.05). In the family level, the abundances of Bacteroidota, WPS-2 and Synergistaceae were decreased (P < 0.05), and the abundance of Campylobacteraceae was increased with the supplementation of 25(OH)D₃ (P = 0.022). Dietary 25(OH)D₃ supplementation increased the abundance of Faecalitalea, Ruminococcus, XIII_AD3011 and Campylobacter (P < 0.05), but decreased those of Colidextribacter, Eggerthellaceae, Bacteroidales, WPS-2, Oscillospira, Oscillibacter, UCG-009, Barnesiellace and UCG-010 at the genus level (P < 0.05). As shown in Fig. 5F, the functional prediction of cecal microorganisms with 25(OH)D₃ supplementation was similar to that of the controls, mainly focused on the function of amino acid transport and metabolism, energy production and conversion, carbohydrate transport and metabolism.

3.8.　 Estimation of the requirement of 25(OH)D₃ in diets

Dietary requirements for 25(OH)D₃ in aged laying ducks, as estimated from quadratic regression analyses of productive performance traits, are shown in Table 6. The requirements of 25(OH)D₃ for Longyan ducks from 60 to 76 wk of age were estimated to be 3377 IU/kg for optimizing egg production, 3434 IU/kg for egg mass, and 3256 IU/kg for FCR.

4.　Discussion

Less

Consistent with previous studies in laying hens (Akbari et al., 2019; Silva, 2017), the present study with laying ducks showed that dietary supplementation of 25(OH)D₃ improved productive performance, including increasing egg production, mass and feed intake, and decreasing FCR. This was possibly related to its positive effects on estrogen and intestinal status; 25(OH)D₃ supplementation increased plasma FSH content and altered intestinal mucosa in a manner consistent with improved function. The differentiation and development of gonads in ducks requires FSH (Ni et al., 2007), and a particular threshold concentration of FSH was necessary for continued follicular development (Liu et al., 2021). The current study has observed that 25(OH)D₃ supplementation increased feed intake of laying ducks, a finding that is consistent with those in pigs and broiler chicks (Driver et al., 2006; Flohr et al., 2014). Bello et al. (2014) found 25(OH)D₃ supplementation might increase nutrient absorption in broilers by enhancing small intestine morphology; comparable changes were noted here in laying ducks.

Supplementation with 25(OH)D₃ decreased yolk weight and ratio, increased albumen ratio decreased VLDL content in egg yolk, along with follicular expression of OVR in ovarian follicle. These results indicated that the lipid deposition in yolk was decreased with the supplementation of 25(OH)D₃ in diets. The lipids of yolk are imported into the follicle in the form of lipoproteins, mainly VLDL (Song et al., 2023), consisting one unit of ApoB and twenty-three units of ApoVLDL-II (Nii et al., 2020). In the process of egg yolk formation, only VLDL with particle diameter of 25 to 44 nm could accumulate in the developing follicles (Yang et al., 2013), and then the OVR was generally considered as a key factor regulating the transport of VLDL and other yolk precursors to follicle (Elkin et al., 2012). These lipids are mainly synthesized by the liver, secreted into the blood, and then transported through the circulatory system to the ovary, where they are transferred into the follicles (Wang et al., 2022a). Therefore, supplemental 25(OH)D₃ decreased egg yolk here in part from downregulated follicular gene expression of OVR; changes in hepatic synthesis of lipids and lipoproteins would also have contributed. During yolk formation, apoVLDL-II interferes with the lipolytic action of LPL on VLDL, resulting in its triacylglycerol content remaining intact for the oocyte, with lipoprotein particles then being engulfed under the mediation of apoB100 (Walzem et al., 1999). The reduced follicular expression of ApoB100 and apoVLDL-II genes from 25(OH)D₃ supplementation may have reduced the synthesis of egg yolk precursors, thereby reducing the weight of yolk.

The NAS reflects the degree of liver nonalcoholic fatty liver disease (Kleiner et al., 2005). The ALT, mainly present in the cytoplasm of liver cells, is involved in the decomposition and synthesis of glutamic acid and pyruvic acid, and its increase in plasma indicates that liver cells are damaged (Yuan et al., 2007). The improvements in hepatic morphology and function with 25(OH)D₃ supplementation here was reflected in reduced NAS of liver and decreased ALT activity in plasma. Dietary with 25(OH)D₃ decreased the liver index, the contents of TC and LDL in plasma, hepatic contents of TG, TC, LDL and VLDL, and increased LPS content. These findings suggest that lipid metabolism and liver status of laying ducks were improved with 25(OH)D₃ supplementation. This outcome is consistent with Yin et al. (2012) who demonstrated that vitamin D₃ modulated lipid metabolism by attenuating hepatic steatosis in the livers of male adult rats. Hepatic lipid accumulation is closely related to de novo lipogenesis, lipid transport and lipid consumption (Cahill, 2006; McGarry and Foster, 1980). The protective effect of vitamin D₃ against hepatic steatosis was mediated by downregulating SREBP-1c and its target genes, ACC and FAS (Yin et al., 2012). Kang et al. (2015) suggested that 1,25(OH)₂D₃ downregulated lipogenesis-associated gene expression (such as SREBP1 and PPAR-γ), which triggered a reduction in hepatic fat synthesis, and suppressed its deposition in adipose tissue. Similarly, the hepatic expression of genes related to the lipogenic proteins, such as ApoB100, apoVLDL-II and LPL, was downregulated here in aged laying ducks by 25(OH)D₃ supplementation. At the same time, hepatic expression of PPARα and SREBP1 was increased. PPARα is predominantly expressed in liver (Yang et al., 2017) and plays an important role in maintaining lipid homeostasis by promoting fatty acid β-oxidation through regulating expression of the respective genes (Escher et al., 2001). The second transcription factor, SREBP1, regulates genes required for glucose metabolism, fatty acid and lipid synthesis (Ferré and Foufelle, 2010). Lipoprotein lipase is the enzyme responsible for the hydrolysis of TG-rich lipoproteins and plays a vital role in directing free fatty acids toward adipose and muscle tissues (Garenc et al., 2001). Therefore, the simultaneous upregulation of the gene expression of hepatic SREBP1 and PPARα, and downregulation of hepatic LPL in the current study indicated that fat synthesis and β-oxidation in the liver were favored in laying ducks with supplementation of 25(OH)D₃. These changes in liver, to some extent, implied that overall metabolism in laying ducks was promoted, which might also contribute to the increased feed intake and egg production noted here; the accelerated metabolism could provide the energy required for production (Li et al., 2019; DePersio et al., 2015). The improved lipid metabolism in plasma and liver with 2400 IU/kg 25(OH)D₃ exceeded that with 4000 IU/kg, indicating no more benefit from higher levels of 25(OH)D₃ in diets of laying ducks. Wen et al. (2019) found that feeding Hy-LineW36 pullets at a higher level 68,348 IU of vitamin D₃ resulted in slower growth of young hens (to 17 wk) and ultimately decreased performance during laying (18 to 68 wk). Note that hepatic HDL content was significantly decreased here with 2400 IU/kg 25(OH)D₃ possibly due to the decreased content of TC; changes in the 2 variables with supplementation were similar. Taken together, these results suggested that appropriate supplementation of 25(OH)D₃ decreased the content of lipid and cholesterol in plasma and liver, reduced the NAS and supported the function and health of the liver, thus helping to maintain homeostasis of lipid metabolism in laying ducks at the late phase of production.

There are several recent reports of the positive role of vitamin D in maintaining intestinal homeostasis in laying hens (Guo et al., 2022). Most notably, vitamin D stabilized inter-epithelial junctions and promoted a balance between the gut microbiota and intestinal immunity (Fakhoury et al., 2020). In the current study, supplementation of 25(OH)D₃ decreased crypt depth, and increased the villus/crypt ratio and expression of ZO-1 and NF-κB in the duodenum of laying ducks. Similarly, dietary 25(OH)D₃ supplementation increased the villus height and villus/crypt ratio in duodenum in breeder geese (Zhang et al., 2023). Expression of genes encoding E-cadherin and some tight junctional components (ZO-1, occludin, and claudins) in various cultured epithelial cells was enhanced by 1,25(OH)₂D₃ (Chen et al., 2015; Zhang et al., 2013). These findings indicate that 25(OH)D₃ improved the morphology and barrier function of intestine, which may be related to the vitamin changing the intestinal microbiota.

The beneficial association of microbiota, or their products (such as short-chain fatty acids), on intestinal homeostasis is established (Clark and Mach, 2016; Guo et al., 2022). There was no difference in the alpha and beta diversity of cecal microbiota among the present treatments, indicating no effect of 25(OH)D₃ supplementation on diversity of cecal microbiota in laying ducks, however, changes in the composition of cecal microbiota were observed. The abundance of WPS-2, Synergistota, Bacteroidales, Colidextribacter, Eggerthellaceae, Oscillospira, Oscillibacter, UCG-009, Barnesiellaceae and Lachnospiraceae_UCG-010 were decreased with supplementation of 25(OH)D₃ in the present study. WPS-2 is an as-yet-uncultured bacterial clade, and it might be involved in metabolic processes and energy utilization in the intestine (Ji et al., 2021). Synergistota was found to be positively correlated with NH₃–N concentration which increases the absorption and utilization of nutrients (Wang et al., 2022b). Bacteroidales was mainly involved in the decomposition of carbohydrates in the intestine, producing butyric acid and acetic acid (Macfarlane and Macfarlane, 2003). From the functional roles of these changes, dietary 25(OH)D₃ supplementation mainly influenced the microbiota involved in the decomposition of carbohydrates. Similarly, the lack of sufficient vitamin D increased the abundance of bacteria in Bacteriodetes phyla (Assa et al., 2014; Ooi et al., 2013). Dietary 25(OH)D₃ supplementation increased the abundance of Faecalitalea, Ruminococcus, XIII_AD3011 and Campylobacter in the cecal microbiota in laying ducks here. The Faecalitalea can produce beneficial short-chain fatty acids (Heinken et al., 2014), which help to maintain intestinal mucosal health and enhance intestinal immune function (Feng et al., 2018). The Ruminococcus could alleviate obesity (Mueller et al., 2021) and showed anti-inflammatory responses (Wan et al., 2022). As a part of the intestinal flora, Campylobacter had no functional influence in mammals and birds (Harvey et al., 1999; Rath et al., 2021). In these respects, the supplementation of 25(OH)D₃ was beneficial in preserving intestinal integrity, health and immune function in laying ducks at the current study, which might be related to the increase of beneficial bacteria (Faecalitalea and Ruminococcus) in the cecal contents. Unfortunately, the functions of Eggerthellaceae, Oscillibacte, Colidextribacter, XIII_AD3011, UCG-009, Barnesiellaceae and Lachnospiraceae_UCG-010 bacteria remain unclear. Overall, it can be inferred that 25(OH)D₃ supplementation can partly inhibit the carbohydrate decomposition and reduce lipid synthesis by decreasing the abundance of bacteria such as Bacteroidales. Additionally, it might contribute to maintaining intestinal barrier integrity and morphological normality by increasing the abundance of beneficial bacteria (Faecalitalea and Ruminococcus) in laying ducks.

For most variables examined here a diet containing 3250 to 3450 IU/kg of 25(OH)D₃ is recommended for laying ducks during the late laying period. This slightly exceeds the levels recommended by China National Standard (GB/T 41189-2021) for the peak phase of production in laying ducks (3000 vs. 2500 IU/kg), which possibly resulted from higher requirements for maintaining eggshell and bone quality of older ducks. Higher supplemental level of 25(OH)D₃ (5000 vs. 2500 IU/kg) could improve productive performance and eggshell quality in laying hens at the late phase of production (60 to 72 wk; Jing et al., 2022). As no feeding standard exists for 25(OH)D₃ in laying ducks at the late phase of production, the present data provide this needed information.

5.　Conclusions

Less

Dietary 25(OH)D₃ supplementation improved the productive performance, lipid metabolism and duodenal morphology, but reduced egg yolk weight in laying ducks. Its beneficial effect for lipid homeostasis stemmed from decreasing the abundance of bacteria involved in carbohydrate metabolism such as Bacteroides and increasing the abundance of beneficial bacteria (Faecalitalea and Ruminococcus) in the cecal contents. A diet that containing 3250 to 3450 IU/kg of 25(OH)D₃ is recommended for laying ducks during the late phase of production (60 to 75 wk).

References

Less

Akbari Moghaddam Kakhki

, Heuthorst

, Mills

, Neijat

, Kiarie

. Interactive effects of calcium and top-dressed 25-hydroxy vitamin D3 on egg production, egg shell quality, and bones attributes in aged Lohmann LSL-lite layers1. Poult Sci 2019;98(3):1254-62.

Assa

, Vong

, Pinnell

, Avitzur

, Johnson-Henry

, Sherman

. Vitamin D deficiency promotes epithelial barrier dysfunction and intestinal inflammation. J Infect Dis 2014;210(8):1296-305.

Bar

, Razaphkovsky

, Vax

, Plavnik

. Performance and bone development in broiler chickens given 25-hydroxycholecalciferol. Br Poult Sci 2003;44(2):224-33.

Bar

, Sharvit

, Noff

, Edelstein

, Hurwitz

. Absorption and excretion of cholecalciferol and of 25-hydroxycholecalciferol and metabolites in birds. J Nutr 1980;110(10):1930-4.

Bello

, Zhai

, Gerard

, Peebles

. Effects of the commercial in ovo injection of 25-hydroxycholecalciferol on broiler posthatch performance and carcass characteristics. Poult Sci 2014;93(1):155-62.

Cahill Jr

. Fuel metabolism in starvation. Annu Rev Nutr 2006;26:1-22.

Chen

, Turner

, Applegate

, Litta

, Kim

. Role of long-term supplementation of 25-hydroxyvitamin D3 on laying hen bone 3-dimensional structural development. Poult Sci 2020;99(11):5771-82.

Chen

, Wang

, Zhu

, Chen

, Zhang

, Chen

, Zuo

, Liu

, Pan

. Protective effect of 1,25-dihydroxyvitamin d3 on lipopolysaccharide-induced intestinal epithelial tight junction injury in caco-2 cell monolayers. Inflammation 2015;38(1):375-83.

China National Standard. Determination of calcium in feeds. GB/T 6436-2018. Beijing: Standards Press of China; 2018a.

China National Standard. Determination of crude protein in feeds-Kjeldahl method. GB/T 6432-2018. Beijing: Standards Press of China; 2018b.

China National Standard. Determination of phosphorus in feeds-Spectrophotometry. GB/T 6437-2018. Beijing: Standards Press of China; 2018c.

China National Standard. Nutrient requirements of egg duck. GB/T 41189-2021. Beijing: Standards Press of China; 2021.

Chou

, Chung

, Yu

. Effects of supplemental 25-hydroxycholecalciferol on growth performance, small intestinal morphology, and immune response of broiler chickens. Poult Sci 2009;88(11):2333-41.

Clark

, Mach

. Role of vitamin d in the hygiene hypothesis: the interplay between vitamin D, vitamin D receptors, gut Microbiota, and immune response. Front Immunol 2016;7:627.

DePersio

, Utterback

, Rochell

, O'Sullivan

, Bregendahl

, Arango

, Parsons

, Koelkebeck

. Effects of feeding diets varying in energy and nutrient density to Hy-Line W-36 laying hens on production performance and economics. Poult Sci 2015;94(2):195-206.

Dos Santos

, Freitas

, Nepomuceno

, Watanabe

, Souza

, Fernandes

, De Abreu Freitas

, Do Nascimento

GAJ

, Aguiar

, De Melo

MCA

. Organic zinc and manganese and 25-hydroxycholecalciferol improves eggshell thickness in late-phase laying hens. Trop Anim Health Prod 2021;53(6):529.

Driver

, Atencio

, Pesti

, Edwards Jr

, Bakalli

. The effect of maternal dietary vitamin D3 supplementation on performance and tibial dyschondroplasia of broiler chicks. Poult Sci 2006;85(1):39-47.

Elkin

, Bauer

, Schneider

. The restricted ovulator chicken strain: an oviparous vertebrate model of reproductive dysfunction caused by a gene defect affecting an oocyte-specific receptor. Anim Reprod Sci 2012;136(1-2):1-13.

England

, Ruhnke

. The influence of light of different wavelengths on laying hen production and egg quality. Worlds Poult Sci J 2020;76(3):443-58.

Escher

, Braissant

, Basu-Modak

, Michalik

, Wahli

, Desvergne

. Rat PPARs: quantitative analysis in adult rat tissues and regulation in fasting and refeeding. Endocrinology 2001;142(10):4195-202.

Fakhoury

HMA

, Kvietys

, AlKattan

, Anouti

, Elahi

, Karras

, Grant

. Vitamin D and intestinal homeostasis: barrier, microbiota, and immune modulation. J Steroid Biochem Mol Biol 2020;200:105663.

Feng

, Ao

, Peng

. Gut microbiota, short-Chain fatty acids, and herbal medicines. Front Pharmacol 2018;9:1354.

Ferré

, Foufelle

. Hepatic steatosis: a role for de novo lipogenesis and the transcription factor SREBP-1c. Diabetes Obes Metab 2010;12(Suppl 2):83-92.

Flohr

, Tokach

, Dritz

, Derouchey

, Goodband

, Nelssen

, Henry

, Tokach

, Potter

, Goff

, Koszewski

, Horst

, Hansen

, Fruge

. Effects of supplemental vitamin D3 on serum 25-hydroxycholecalciferol and growth of preweaning and nursery pigs. J Anim Sci 2014;92(1):152-63.

Garenc

, Pérusse

, Bergeron

, Gagnon

, Chagnon

, Borecki

, Leon

, Skinner

, Wilmore

, Rao

, Bouchard

. Evidence of LPL gene-exercise interaction for body fat and LPL activity: the HERITAGE Family Study. J Appl Physiol 2001;91(3):1334-40.

Guo

, Geng

, Abbas

, Zhen

, Wang

, Huang

, Guo

, Ma

, Wang

. Vitamin D3 nutritional status affects gut health of salmonella-challenged laying hens. Front Nutr 2022;9:888580.

Han

, Kim

, Kil

. Effect of dietary concentrations of metabolizable energy and neutral detergent fiber on productive performance, egg quality, fatty liver incidence, and hepatic fatty acid metabolism in aged laying hens. Poult Sci 2023;102(4):102497.

Harvey

, Young

, Ziprin

, Hume

, Genovese

, Anderson

, Droleskey

, Stanker

, Nisbet

. Prevalence of Campylobacter spp isolated from the intestinal tract of pigs raised in an integrated swine production system. J Am Vet Med Assoc 1999;215(11):1601-4.

Heinken

, Khan

, Paglia

, Rodionov

, Harmsen

, Thiele

. Functional metabolic map of Faecalibacterium prausnitzii, a beneficial human gut microbe. J Bacteriol 2014;196(18):3289-302.

, Williams

, Montgomery

, Wong

, Zaugg

, Berengut

, Bissett

, Chuvochina

, Hugenholtz

, Ferrari

. Candidatus Eremiobacterota, a metabolically and phylogenetically diverse terrestrial phylum with acid-tolerant adaptations. ISME J 2021;15(9):2692-707.

Jing

, Wang

, Song

, Xu

, Liu

, Wei

, Zhu

, Liu

, Wei

, Xu

. A Comparison between Vitamin D3 and 25-Hydroxyvitamin D3 on laying performance, eggshell quality and ultrastructure, and plasma calcium levels in late period laying hens. Animals (Basel) 2022;12(20):2824.

Kang

, Lee

, An

, Lee

, Kwon

, Kim

, Hwang

, Jung

, Yang

, Kim

, An

. The effects of vitamin D3 on lipogenesis in the liver and adipose tissue of pregnant rats. Int J Mol Med 2015;36(4):1151-8.

Kleiner

, Brunt

, Van Natta

, Behling

, Contos

, Cummings

, Ferrell

, Liu

, Torbenson

, Unalp-Arida

, Yeh

, McCullough

, Sanyal

. Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology 2005;41(6):1313-21.

Koreleski

, Świątkiewicz

. Efficacy of different levels of a cholecalciferol 25-OH-derivative in diets with two limestone forms in laying hen nutrition. J Anim Feed Sci 2005;14:305-15.

Lee

, Lee

, Lim

. Vitamin D3 improves lipophagy-associated renal lipid metabolism and tissue damage in diabetic mice. Nutr Res 2020;80:55-65.

, Mihalcioiu

, Li

, Zakikhani

, Camirand

, Kremer

. Vitamin D prevents lipid accumulation in murine muscle through regulation of PPARγ and perilipin-2 expression. J Steroid Biochem Mol Biol 2018;177:116-24.

, Zhang

, Yao

, Yang

, Ma

. (-)-Hydroxycitric acid suppresses lipid droplet accumulation and accelerates energy metabolism via activation of the adiponectin-AMPK signaling pathway in broiler chickens. J Agric Food Chem 2019;67(11):3188-97.

Liu

, Zeng

, Li

, Rong

, Hu

, Zhang

, Liu

. Expression and analysis of ESR1, IGF-1, FSH, VLDLR, LRP, LH, PRLR genes in Pekin duck and Black Muscovy duck. Gene 2021;769:145183.

Livak

, Schmittgen

. Analysis of relative gene expression data using real-time quantitative PCR and the 2 ^ΔΔCT method. Methods 2001;25(4):402-8.

Macfarlane

, Macfarlane

. Regulation of short-chain fatty acid production. Proc Nutr Soc 2003;62(1):67-72.

Matthews

, D'Angelo

, Drelich

, Welsh

. Adipose-specific Vdr deletion alters body fat and enhances mammary epithelial density. J Steroid Biochem Mol Biol 2016;164:299-308.

McGarry

, Foster

. Regulation of hepatic fatty acid oxidation and ketone body production. Annu Rev Biochem 1980;49:395-420.

Mueller

, Differding

, Zhang

, Maruthur

, Juraschek

, Miller ER 3rd, Appel

, Yeh

. Metformin affects gut microbiome composition and function and circulating short-chain fatty acids: a randomized trial. Diabetes Care 2021;44(7):1462-71.

Mutt

, Hyppönen

, Saarnio

, Järvelin

, Herzig

. Vitamin D and adipose tissue-more than storage. Front Physiol 2014;5:228.

Nii

, Bungo

, Isobe

, Yoshimura

. Intestinal inflammation induced by dextran sodium sulphate causes liver inflammation and lipid metabolism disfunction in laying hens. Poult Sci 2020;99(3):1663-77.

, Zhou

, Lu

, Grossmann

, Zhao

. Developmental changes of FSH-R, LH-R, ER-beta and GnRH-I expression in the ovary of prepubertal ducks (Anas platyrhynchos). Anim Reprod Sci 2007;100(3-4):318-28.

Ooi

, Li

, Rogers

, Cantorna

. Vitamin D regulates the gut microbiome and protects mice from dextran sodium sulfate-induced colitis. J Nutr 2013;143(10):1679-86.

Rath

, Rautenschlein

, Rzeznitzeck

, Breves

, Hewicker-Trautwein

, Waldmann

, von Altrock

. Impact of campylobacter spp. on the integrity of the porcine gut. Animals (Basel) 2021;11(9):2742.

Rattanawut

, Pimpa

, Yamauchi

. Effects of dietary bamboo vinegar supplementation on performance, eggshell quality, ileal microflora composition, and intestinal villus morphology of laying hens in the late phase of production. Anim Sci J 2018;89(11):1572-80.

Rayalam

, Della-Fera

, Ambati

, Yang

, Park

, Baile

. Enhanced effects of 1,25(OH)(2)D(3) plus genistein on adipogenesis and apoptosis in 3T3-L1 adipocytes. Obesity (Silver Spring) 2008;16(3):539-46.

Saadatmand

, Toghyani

, Gheisari

. Effects of dietary fiber and threonine on performance, intestinal morphology and immune responses in broiler chickens. Anim Nutr 2019;5(3):248-55.

Silva

. Effects of dietary 25-hydroxycholecalciferol on growth, production performance, eggshell quality and bone traits of brown egg layers housed under commercial conditions. Animals 2017;64(13):82-94.

Sinclair-Black

, Garcia

, Ellestad

. Physiological regulation of calcium and phosphorus utilization in laying hens. Front Physiol 2023;14:1112499.

Soares JH Jr, Kerr

, Gray

. 25-hydroxycholecalciferol in poultry nutrition. Poult Sci 1995;74(12):1919-34.

Song

, Wang

, Zhou

, Sun

, Ao

, Hao

, Gao

, Xu

, Li

, Jia

, Wei

. Yolk precursor synthesis and deposition in hierarchical follicles and effect on egg production performance of hens. Poult Sci 2023;102(7):102756.

Terry

, Lanenga

, McNaughton

, Stark

. Safety of 25-hydroxyvitamin D3 as a source of vitamin D3 in layer poultry feed. Vet Hum Toxicol 1999;41(5):312-6.

Trott

, Giannitti

, Rimoldi

, Hill

, Woods

, Barr

, Anderson

, Mete

. Fatty liver hemorrhagic syndrome in the backyard chicken: a retrospective histopathologic case series. Vet Pathol 2014;51(4):787-95.

Tůmová

, Uhlířová

, Tůma

, Chodová

, Máchal

. Age related changes in laying pattern and egg weight of different laying hen genotypes. Anim Reprod Sci 2017;183:21-6.

Van Den Brand

, Parmentier

, Kemp

. Effects of housing system (outdoor vs cages) and age of laying hens on egg characteristics. Br Poult Sci 2004;45(6):745-52.

Walzem

, Hansen

, Williams

, Hamilton

. Estrogen induction of VLDLy assembly in egg-laying hens. J Nutr 1999;129(2S Suppl):467S-72S.

Wan

, Wang

, Zhong

, Chen

, Han

, Liu

, Zhao

, Lv

, Hou

, Yi

, Zhang

. Supplementation with Chinese medicinal plant extracts from lonicera hypoglauca and scutellaria baicalensis mitigates colonic inflammation by regulating oxidative stress and gut microbiota in a colitis mouse model. Front Cell Infect Microbiol 2022;11:798052.

Wang

, Ding

, Zeng

, Bai

, Zhang

, Mao

, Xu

, Zhuo

, Xuan

, Peng

, Liu

, Yin

. Dietary 25-hydroxyvitamin D improves productive performance and intestinal health of laying hens under Escherichia coli lipopolysaccharide challenge. Poult Sci 2023;102(3):102371.

Wang

, Qiu

, Gong

, Celi

, Yan

, Ding

, Bai

, Zeng

, Mao

, Xu

, Wu

, Zhang

. Effect of dietary 25-hydroxycholecalciferol supplementation and high stocking density on performance, egg quality, and tibia quality in laying hens. Poult Sci 2020;99(5):2608-15.

Wang

, Zhang

, Yan

, Qiu

, Yin

, Ding

, Bai

, Zeng

, Mao

, Zhang

, Wu

, Xuan

, Shan

. Dietary 25-hydroxyvitamin D improves intestinal health and microbiota of laying hens under high stocking density. Poult Sci 2021;100(7):101132.

Wang

, Wang

, Zhang

, Wu

, Qi

. Supplemental clostridium butyricum modulates lipid metabolism through shaping gut microbiota and bile acid profile of aged laying hens. Front Microbiol 2020;11:600.

Wang

, Wang

, Zhang

, Wu

, Qi

. Transcriptome analysis reveals mechanism underlying the differential intestinal functionality of laying hens in the late phase and peak phase of production. BMC Genomics 2019;20(1):970.

Wang

, Wang

, Shi

, Ye

, Luo

, Geng

. Quantitative proteomic analyses during formation of chicken egg yolk. Food Chem 2022a;374:131828.

Wang

, Xia

, Yang

, Liu

, Cui

. Evaluating starter feeding on ruminal function in yak calves: combined 16S rRNA sequencing and metabolomics. Front Microbiol 2022b;13:821613.

Wen

, Livingston

, Persia

. Effect of high concentrations of dietary vitamin D3 on pullet and laying hen performance, skeleton health, eggshell quality, and yolk vitamin D3 content when fed to W36 laying hens from day of hatch until 68 wk of age. Poult Sci 2019;98(12):6713-20.

Wistedt

, Ridderstråle

, Wall

, Holm

. Age-related changes in the shell gland and duodenum in relation to shell quality and bone strength in commercial laying hen hybrids. Acta Vet Scand 2019;61(1):14.

Yang

, Xiao

, Wang

. Peroxisome proliferator-activated receptor α ligands and modulators from dietary compounds: types, screening methods and functions. J Diabetes 2017;9(4):341-52.

Yang

, Tai

, Ma

, Xu

, Hao

, Han

, Li

, Deng

. Cecum microbiome and metabolism characteristics of Silky Fowl and White Leghorn chicken in late laying stages. Front Microbiol 2022;13:984654.

Yang

, Suh

, Choi

, Shin

, Han

, Lee

. Loss of fat with increased adipose triglyceride lipase-mediated lipolysis in adipose tissue during laying stages in quail. Lipids 2013;48(1):13-21.

Yin

, Yu

, Xia

, Luo

, Lu

, Ling

. Vitamin D attenuates high fat diet-induced hepatic steatosis in rats by modulating lipid metabolism. Eur J Clin Invest 2012;42(11):1189-96.

Yuan

, Gong

, Li

. Ginkgo biloba extract protects against alcohol-induced liver injury in rats. Phytother Res 2007;21(3):234-8.

Zhang

, Zhang

, Xing

, Wang

, Fan

, Kong

, Li

, Wang

. Dietary cholecalciferol and 25-hydroxycholecalciferol supplementation interact to modulate reproductive performance, egg quality, serum antioxidant capacity, intestinal morphology and tibia quality of breeder geese. Br Poult Sci 2023;11:1-9.

Zhang

, Piao

. Use of 25-hydroxyvitamin D3 in diets for sows: a review. Anim Nutr 2021;7(3):728-36.

Zhang

, Wu

, Sun

. Vitamin D, vitamin D receptor, and tissue barriers. Tissue Barriers 2013;1(1):e23118.

Appendix

Less

Year 2024 volume 19 Issue 1

PDF

Cite this Article

BibTeX

Article Info

doi: 10.1016/j.aninu.2024.04.029

Receive Date：2023-12-07
Online Date：2026-01-28
Published：2024-12-10

Article Data

Affiliations

History

Received：2023-12-07
Revised：2024-02-29
Accepted：2024-04-04

Affiliations

Corresponding:

Corresponding authors. E-mail addresses: zhangyanan@gdaas.cn (Y. Zhang),

zhengchuntian@gdaas.cn (C. Zheng).

References

Share

https://castjournals.cast.org.cn/joweb/aninu/EN/10.1016/j.aninu.2024.04.029

Share to

Scan QR to access full text

Cite this article

BibTeX

Citations

表12种不同金属材料的力学参数

科 Family	属数 Number of genus	种数 Number of species	占总种数比例 Percentage of total species (%)	属 Genus	种数 Number of species	占总种数比例 Percentage of total species (%)
鹅膏菌科Amanitaceae	2	11	5.26	鹅膏菌属 Amanita	10	4.78
小菇科 Mycenaceae	2	12	5.74	丝盖伞属 Inocybe	5	2.39
多孔菌科 Polyporaceae	8	14	6.70	蜡蘑属 Laccaria	5	2.39
红菇科 Russulaceae	3	23	11.00	小皮伞属 Marasmius	6	2.87
				小菇属 Mycena	11	5.26
				光柄菇属 Pluteus	5	2.39
				红菇属 Russula	17	8.13
				栓菌属 Trametes	5	2.39

关闭全屏

BibTeX
EndNote
RefWorks
TxT

Table 1 Ingredients and nutrient levels of basal diets (air-dry basis, %).

Ingredients	Content	Nutrient level²	Content
Corn (CP 7.8%)	53.90	AME, MJ/kg	10.46
Soybean meal (CP 43%)	25.30	Crude protein	17.06
Wheat bran (CP 15.6%)	8.93	Calcium	3.59
Limestone	8.90	Total phosphorus	0.60
DL-Methionine	0.16	Available phosphorus	0.37
L-Lysine sulfate	0.03	Lysine	0.42
Calcium hydrogen phosphate	1.43	Methionine	0.88
Salt	0.35
Premix¹	1.00
Total	100

AME = apparent metabolizable energy; CP = crude protein. ¹ Premix provided the following per kilogram of diet: vitamin A 7500 IU, vitamin E 20.00 IU, vitamin K₃ 2.50 mg, vitamin B₁ 3.45 mg, vitamin B₂ 6.00 mg, vitamin B₆ 2.50 mg, vitamin B₁₂ 0.02 mg, Choline chloride 600 mg, pantothenic acid 20.58 mg, folic acid 1.00 mg, biotin 0.20 mg, nicotinic acid 27.13 mg, Fe (FeSO₄·H₂O) 75.00 mg, Cu (CuSO₄·5H₂O) 10 mg, Mn (MnSO₄·H₂O) 50.00 mg, Zn (ZnSO₄·H₂O) 43.75 mg, Se (Na₂SeO₃) 0.30 mg, I (KI) 0.44 mg. ² AME, available phosphorus, lysine and methionine were calculated according to China National Standard (GB/T 41189-2021), and the rest of the nutrient levels were measured.

Table 2 Primer sequence information.

Genes	Primer sequence (5′—3′)	Accession number
β-Actin	Forward: GCTATGTCGCCCTGGATTT Reverse: GGATGCCACAGGACTCCATAC	NM-001310421.1
OVR	Forward: ACTGTCCAGCTGGGTTTGAG Reverse: ACAGCTTTGCACACTCCTGTA	NM_001310401.1
PPARα	Forward: AATGGCTGACCTCCGACAAC Reverse: ACTTGTCCCTGTAGATTTCCTG	NM_001310383.1
LXR	Forward: CCTGCTGCTCCTTACTCTGC Reverse: GTGAAAGCCCTTCCTCCTCC	NM_001310423.1
SREBP1	Forward: CGTTGGTGAGCGGGGG Reverse: CGTTGATGGAGGAGCGGTAG	XM_038187023.1
ApoB100	Forward: AGCCAGGCTGATTTCGTCAA Reverse: CTCAACCCTGAAGGTGGCAT	XM_005012904.5
ApoVLDL-II	Forward:GGCATTGGTGATAGCTCTGATCCTG Reverse: AGGTCCTGGTCCCAACAACTACTG	NM_001310364.1
LPL	Forward: CTTGCTGGGGTACAGTCTGG Reverse: CGTAAGGGCATCAGCGTACT	XM_027446391.2
ACC	Forward: TATGGGTGTCTTCGCAGCAG Reverse: AGTCTGGGCTCCATGTCTCT	XM_038165892.
FAS	Forward: CAGCGGCAGTTGGTCAGTT Reverse: GGCTCTCTCTCACATTGGCAG	AY613443.1
INSR	Forward: CACGCACTACCTGGTGTTCT Reverse: CAGGAACAACACTCTCCGCT	XM_038169078.1
ZO-1	Forward: TTGATGATTGCATGCAGCGG Reverse: CATCTGCAAGACGGTCAGGT	XM_038184899.1
NF-κB	Forward: CCTCACCAGGAGGACAACAC Reverse: TCAGTTTGCGGAAGGAGGTC	XM_038177856.1
TNF-α	Forward: ATTCCCCGAGGCACGAATTT Reverse: TCACTATGAGAGGCCTGGCT	XM_027471963.2

OVR = ovarian very low-density lipoprotein receptor; PPARα = peroxisome proliferator-activated receptor-α; LXR = liver X receptor; SREBP1 = sterol regulatory element binding protein-1; ApoB100 = apolipoprotein B 100; ApoVLDL-II = apolipoprotein very low-density lipoprotein-II; LPL = lipoprotein lipase; ACC = acetyl-CoA carboxylase; FAS = fatty acid synthase; INSR = insulin receptor; ZO-1 = zonula occludens protein 1; NF-κB = nuclear factor-κ-gene binding; TNF-α = tumor necrosis factor-α.

Table 3 Dietary 25(OH)D₃ supplementation improved productive performance in aged laying ducks.¹

Item	25(OH)D₃, IU/kg						SEM	P-value
Item	0	800	1600	2400	3200	4000	SEM	ANOVA	Linear	Quadratic
Egg production, %
1 to 4 wk	83.9	87.1	87.8	89.3	88.8	89.1	0.67	0.164	0.014	0.020
5 to 8 wk	74.5^b	78.4^b	82.7^ab	87.2^a	88.2^a	88.8^a	1.27	<0.001	<0.001	<0.001
9 to 12 wk	67.8^b	74.1^ab	75.5^ab	80.0^a	81.3^a	80.2^a	1.25	0.007	<0.001	<0.001
13 to 16 wk	60.3^b	75.7^a	74.0^a	82.0^a	79.8^a	80.6^a	1.72	<0.001	<0.001	<0.001
1 to 16 wk	71.6^b	78.8^a	80.0^a	84.6^a	84.5^a	84.7^a	1.06	<0.001	<0.001	<0.001
Average egg weight, g
1 to 4 wk	69.0	69.8	70.9	70.1	69.1	75.5	0.75	0.100	0.051	0.073
5 to 8 wk	70.2	70.6	71.1	71.7	70.1	71.3	0.21	0.114	0.264	0.318
9 to 12 wk	69.3	70.8	70.6	71.0	70.0	70.8	0.24	0.294	0.237	0.241
13 to 16 wk	69.1	70.1	69.2	68.6	69.3	70.7	0.47	0.839	0.593	0.644
1 to 16 wk	69.4^b	70.3^ab	70.5^ab	70.4^ab	69.6^b	72.1^a	0.26	0.036	0.030	0.075
Egg mass, g
1 to 4 wk	57.8	60.9	62.3	62.7	61.4	67.3	0.85	0.360	0.003	0.013
5 to 8 wk	52.1^c	55.4^bc	58.9^ab	62.5^a	61.8^a	63.4^a	0.95	<0.001	<0.001	<0.001
9 to 12 wk	46.9^b	51.9^ab	51.9^ab	58.0^a	56.9^a	55.5^a	0.97	0.003	0.001	<0.001
13 to 16 wk	41.5^b	53.1^a	52.4^a	56.5^a	54.3^a	55.0^a	1.25	0.002	0.002	<0.001
1 to 16 wk	49.6^c	55.3^b	56.4^ab	59.9^a	58.6^ab	60.3^a	0.81	<0.001	<0.001	<0.001
Average daily feed intake, g
1 to 4 wk	166	168	169	169	169	169	0.4	0.094	0.014	0.012
5 to 8 wk	162^b	166^ab	167^a	171^a	171^a	171^a	0.8	0.001	<0.001	<0.001
9 to 12 wk	162	164	165	169	168	167	0.8	0.083	0.010	0.014
13 to 16 wk	153^b	161^a	162^a	165^a	164^a	163^a	1.1	0.011	0.003	0.001
1 to 16 wk	161^b	165^a	166^a	168^a	168^a	168^a	0.7	0.003	<0.001	<0.001
FCR, g:g
1 to 4 wk	2.89^a	2.77^ab	2.72^ab	2.70^ab	2.76^ab	2.55^b	0.031	0.049	0.005	0.020
5 to 8 wk	3.13^a	3.02^ab	2.85^bc	2.74^c	2.77^c	2.70^c	0.036	<0.001	<0.001	<0.001
9 to 12 wk	3.48^a	3.18^b	3.19^b	2.92^b	2.96^b	3.02^b	0.047	0.002	<0.001	<0.001
13 to 16 wk	3.69^a	3.05^b	3.13^b	2.96^b	3.04^b	2.99^b	0.064	0.003	0.003	0.001
1 to 16 wk	3.30^a	3.00^b	2.97^bc	2.83^bc	2.88^bc	2.82^c	0.035	<0.001	<0.001	<0.001
Broken egg rate, %
1 to 4 wk	4.11	3.38	3.90	3.02	3.69	2.61	0.268	0.624	0.181	0.406
5 to 8 wk	5.16	4.57	4.98	4.10	4.10	3.86	0.283	0.745	0.132	0.328
9 to 12 wk	5.45	4.92	5.01	4.70	4.24	5.21	0.315	0.929	0.589	0.662
13 to 16 wk	5.08	5.34	4.65	4.52	4.35	2.19	0.436	0.367	0.048	0.083
1 to 16 wk	4.95	4.55	4.63	4.09	4.10	3.47	0.266	0.692	0.088	0.231

25(OH)D₃ = 25-hydroxyvitamin D₃; FCR = feed conversion ratio. Within a row, values with different superscript letters differ at P < 0.05. ¹ Mean of 6 replicates (12 ducks per replicate) per treatment.

Table 4 Dietary 25(OH)D₃ supplementation affected egg quality in aged laying ducks.¹

Item	25(OH)D₃, IU/kg						SEM	P-value
Item	0	800	1600	2400	3200	4000	SEM	ANOVA	Linear	Quadratic
Egg weight, g
4 wk	69.6	68.4	70.4	69.2	69.4	68.8	0.35	0.714	0.750	0.833
8 wk	71.8	69.8	71.9	70.9	69.5	70.6	0.36	0.276	0.284	0.561
12 wk	71.4	71.1	72.2	72.3	71.9	70.2	0.35	0.532	0.639	0.273
16 wk	69.3	69.0	69.1	69.6	68.6	69.4	0.48	0.996	0.966	0.996
Mean	70.5	69.6	70.9	70.5	69.9	69.7	0.23	0.517	0.458	0.590
Yolk weight, g
4 wk	22.9	22.6	22.4	22.7	22.7	22.4	0.17	0.962	0.658	0.860
8 wk	23.6	21.9	23.1	22.6	23.3	22.9	0.20	0.217	0.966	0.694
12 wk	24.3^a	23.2^b	22.8^b	22.7^b	22.9^b	23.1^b	0.16	0.043	0.031	0.003
16 wk	24.2^a	22.3^b	22.8^ab	22.9^ab	22.2^b	23.4^ab	0.21	0.043	0.361	0.044
Mean	23.7^a	22.5^b	22.8^b	22.7^b	22.8^b	23.0^b	0.12	0.039	0.213	0.028
Albumen weight, g
4 wk	40.2	39.5	41.5	40.0	40.2	39.7	0.38	0.721	0.818	0.744
8 wk	41.7	41.4	42.1	41.6	39.7	41.2	0.26	0.107	0.121	0.298
12 wk	41.2^bc	41.5^abc	42.8^ab	43.2^a	42.5^ab	40.5^c	0.28	0.027	0.970	0.004
16 wk	38.8	40.6	41.5	41.0	40.8	39.9	0.41	0.488	0.512	0.113
Mean	40.5	40.7	42.0	41.5	40.8	40.3	0.21	0.140	0.804	0.039
Yolk ratio, %
4 wk	33.0	33.0	31.8	32.8	32.8	32.7	0.31	0.907	0.849	0.846
8 wk	32.9	31.3	32.2	31.9	33.6	32.4	0.23	0.077	0.377	0.453
12 wk	33.9^a	32.7^b	31.5^b	31.4^b	31.8^b	32.9^b	0.22	<0.001	0.070	<0.001
16 wk	35.1^a	32.3^c	32.6^ab	32.9^ab	32.4^c	33.7^b	0.23	<0.001	0.198	0.001
Mean	33.7^a	32.3^b	32.0^b	32.3^b	32.6^ab	32.9^ab	0.16	0.022	0.406	0.003
Albumen ratio, %
4 wk	57.6	57.6	59.0	57.8	57.8	57.6	0.32	0.818	0.953	0.700
8 wk	58.1	59.4	58.6	58.7	57.2	58.3	0.23	0.135	0.253	0.416
12 wk	57.6^b	58.4^ab	59.3^a	59.5^a	59.1^a	57.8^b	0.20	0.005	0.429	<0.001
16 wk	56.2^c	58.8^ab	59.1^ab	58.9^ab	59.4^a	57.5^bc	0.29	0.003	0.156	<0.001
Mean	57.4^c	58.5^ab	59.0^a	58.7^ab	58.4^abc	57.8^bc	0.17	0.041	0.677	0.004
Albumen height, mm
4 wk	8.03	7.67	7.83	7.98	8.11	8.04	0.086	0.723	0.390	0.553
8 wk	7.76	7.69	7.98	7.82	7.91	7.92	0.100	0.970	0.533	0.813
12 wk	7.67	7.45	7.56	7.55	7.47	7.46	0.051	0.836	0.354	0.631
16 wk	7.61	7.09	7.56	7.37	7.20	7.27	0.084	0.447	0.367	0.654
Mean	7.77	7.48	7.73	7.68	7.67	7.67	0.048	0.622	0.971	0.938
Yolk color
4 wk	4.39	4.67	4.50	4.61	4.45	4.39	0.052	0.552	0.616	0.326
8 wk	4.72	5.00	4.89	4.61	4.78	4.89	0.064	0.589	0.937	0.980
12 wk	4.61	5.03	4.72	4.89	4.61	4.78	0.065	0.396	0.854	0.734
16 wk	5.06	5.17	4.95	5.17	5.17	4.94	0.046	0.487	0.726	0.719
Mean	4.69	4.97	4.76	4.82	4.75	4.75	0.034	0.244	0.651	0.505
Haugh unit
4 wk	87.2	85.0	85.6	88.1	87.4	87.1	0.53	0.545	0.392	0.660
8 wk	85.0	84.9	86.2	84.4	86.1	86.6	0.54	0.845	0.376	0.639
12 wk	84.9	83.2	83.3	83.7	83.5	83.6	0.36	0.794	0.478	0.480
16 wk	84.1	80.6	82.8	82.2	81.3	81.7	0.55	0.583	0.375	0.576
Mean	85.3	83.4	84.5	84.6	84.6	84.8	0.27	0.576	0.865	0.635

25(OH)D₃ = 25-hydroxyvitamin D₃. Within a row, values with different superscript letters differ at P < 0.05. ¹ Mean of 6 replicates (3 eggs per replicate) per treatment.

Table 5 Dietary 25(OH)D₃ supplementation affected lipid metabolism indices in plasma, liver and yolk in aged laying ducks.¹

Item	25(OH)D₃, IU/kg						SEM	P-value
Item	0	800	1600	2400	3200	4000	SEM	ANOVA	Linear	Quadratic
Plasma
TG, mmol/L	8.13	8.47	8.94	8.93	8.66	9.42	0.165	0.317	0.037	0.114
TC, mmol/L	4.01^b	3.54^b	2.66^b	2.26^b	3.46^b	5.86^a	0.296	0.003	0.160	<0.001
HDL, mmol/L	12.8^a	10.6^ab	10.1^b	9.2^bc	7.6^c	10.1^b	0.39	0.002	0.001	0.003
LDL, mmol/L	1.81^a	1.41^b	1.47^ab	1.50^ab	1.01^c	1.26^bc	0.061	0.002	0.001	0.003
VLDL, μg/mL	5.79	6.43	5.15	5.24	5.67	5.10	0.167	0.162	0.102	0.261
INS, μIU/mL	8.30^ab	9.28^a	9.14^a	7.01^c	7.53^c	8.02^bc	0.192	0.001	0.024	0.080
FSH, μIU/mL	1.55^b	1.42^b	2.03^ab	3.07^a	3.19^a	3.19^a	0.194	0.002	<0.001	<0.001
E₂, ng/mL	94.9	89.6	78.9	89.0	96.4	94.1	4.79	0.972	0.791	0.705
LH, mU/mL	3.53	4.70	2.53	2.62	2.88	3.56	0.260	0.138	0.332	0.291
Liver
Body weight, kg	1.32	1.43	1.37	1.34	1.35	1.38	0.018	0.791	0.830	0.951
Liver weight, g	43.7	39.1	38.8	38.7	44.4	39.7	1.21	0.596	0.876	0.705
Liver index, %	3.33	2.75	2.83	2.91	3.25	2.84	0.076	0.120	0.596	1.480
LPS, μmol/g prot	94.3^cd	107^bc	119^ab	120^ab	128^a	82.7^d	3.28	<0.001	0.247	0.006
Liver fat rate, %	33.1	30.6	25.6	29.8	31.0	30.6	0.94	0.333	0.319	0.245
TG, μmol/g prot	76.6^a	61.6^b	55.3^b	55.1^b	57.9^b	56.5^b	1.77	<0.001	0.001	<0.001
TC, μmol/g prot	5.89^b	7.32^a	4.85^bcd	3.64^d	4.43^cd	4.98^bc	0.249	<0.001	0.003	0.003
HDL, μmol/g prot	3.03^b	2.67^b	2.67^b	0.50^c	3.18^b	3.96^a	0.198	<0.001	0.332	<0.001
LDL, μmol/g prot	37.4^a	19.7^b	10.9^c	10.8^c	12.4^c	12.6^c	1.73	<0.001	<0.001	<0.001
VLDL, μg/mg	0.024^ab	0.030^a	0.022^b	0.019^b	0.020^b	0.020^b	0.0011	0.029	0.019	0.065
Yolk
TG, mmol/g prot	9.29^b	9.54^b	8.32^b	8.61^b	9.79^b	14.01^a	0.374	<0.001	0.001	<0.001
TC, mmol/g prot	26.6	25.2	25.0	26.6	26.3	26.6	0.32	0.497	0.499	0.452
VLDL, μg/mg	0.014^a	0.011^b	0.012^ab	0.012^ab	0.009^b	0.009^b	0.0004	0.008	0.001	0.003

25(OH)D₃ = 25-hydroxyvitamin D₃; TG = triglyceride; TC = total cholesterol; HDL = high-density lipoprotein; LDL = low-density lipoprotein; VLDL = very low-density lipoprotein; INS = insulin; FSH = follicle stimulating hormone; E₂ = estradiol; LH = luteinizing hormone; LPS = lipase. Within a row, values with different superscript letters differ at P < 0.05. ¹ Mean of 6 replicates (2 ducks per replicate) per treatment.

Table 6 Estimation of the dietary 25(OH)D₃ requirements based on quadratic regressions of egg production, egg mass and FCR on dietary 25(OH)D₃ supplemental levels.

Item	Time, wk	Regression equation¹	R²	P-value	Dietary 25(OH)D₃ requirement,² IU/kg
Egg production, %	1 to 16	Y = −1.131X² + 7.64X + 72.061	0.965	0.007	3377.54
Egg mass, g/d	1 to 16	Y = −0.8334X² + 5.725X + 50.113	0.937	0.016	3434.73
FCR, g:g	1 to 16	Y = 0.041X² − 0.267X + 3.262	0.926	0.020	3256.10

25(OH)D₃ = 25-hydroxyvitamin D₃; FCR = feed conversion ratio. ¹ Y is the dependent variable and X is the dietary 25(OH)D₃ supplemental level (IU/kg). ² The dietary 25(OH)D₃ supplemental level giving 95% of the maximal response.

Fig. 1. Dietary 25(OH)D₃ supplementation reduced liver steatosis and improved its function in aged laying ducks. (A) The images of liver sections stained with hematoxylin and eosin. Steatosis is shown by the blue arrow. Inflammation or necrosis are shown by the red arrow. (B) The nonalcoholic fatty liver disease activity score (NAS) of the liver. (C–D) The activities of AST and ALT in duck plasma, respectively. AST = aspartate transaminase; ALT = alanine aminotransferase. ^a–cBars with different superscript letters differ at P < 0.05. 25(OH)D₃ = 25-hydroxyvitamin D₃; L = linear effect; Q = quadratic effect; CON = control.

Fig. 2. Dietary 25(OH)D₃ supplementation affected the gene expression related lipid metabolism in ovarian follicle and liver in aged laying ducks. (A) The gene expression of OVR in ovarian follicle. (B–J) The genes expression of PPARα, FAS, ACC, SREBP1, LXR, ApoB100, apoVLDL-II, LPL and INSR in the liver, respectively. ^a–cBars with different superscript letters differ at P < 0.05. L = linear effect; Q = quadratic effect; CON = control; OVR = ovarian very low-density lipoprotein receptor; PPARα = peroxisome proliferator-activated receptor-α; FAS = fatty acid synthase; ACC = acetyl-CoA carboxylase; SREBP1 = sterol regulatory element binding protein-1; LXR = liver X receptor; ApoB100 = apolipoprotein B 100; apoVLDL-II = apolipoprotein very low-density lipoprotein-II; LPL = lipoprotein lipase; INSR = insulin receptor.

Fig. 3. Dietary 25(OH)D₃ supplementation improved duodenum morphology and mRNA values of tight junction proteins in aged laying ducks. (A–C) The indices of morphology in duodenum. (D–F) The indices of intestinal barrier in duodenum. ^a–cBars with different superscript letters differ at P < 0.05. L = linear effect; Q = quadratic effect; CON = control; ZO-1 = zonula occludens protein 1; NF-κB = nuclear factor-κ-gene binding; TNF-α = tumor necrosis factor-α.

Fig. 4. Classification and diversity analysis of cecal microorganisms. (A) Venn diagram illustrates the numbers of unique and common operational taxonomic units (OUT) in each group. (B) The phylum-level species-sample association is displayed using the Circos plot. (C) The core analysis diagram is utilized to explain how the core OTU changed as sample size increased. (D) Beta diversity analysis was performed by principal co-ordinate analysis (PCoA), in which a sample is represented by each point. To distinguish the impacts among treatments, ellipses are used to identify the points that share the same color. (E) The number of OTUs in each group, and alpha diversity analysis. Alpha diversity indicated by Simpson index, abundance-based coverage estimator (ACE) index, Shannon index and Chao1 index.

Fig. 5. Analysis of taxonomic composition and prediction of flora function. (A–E) These represent the differences in microbial composition among treatments. (F) COG function classification analysis. Different color blocks represented different functions, and their width indicated the abundance of the flora under this function. *P < 0.05, **P < 0.01. CON = control; COG = cluster of orthologous groups; WPS-2 = Wittenberg polluted soil-2 bacteria.

Articles: Latest Articles; Most Read; Collections

Updates: Events; News; Multimedia

About: About Us

Contact

No. 86 Xueyuan South Road, Haidian District, Beijing

100081

010-62199257

qkjq@cast.org.cn

Copyright © 2025 China Association for Science and Technology. All rights reserved. For all open access content, the relevant licensing terms apply.
Sponsored by the Office of the Leading Group for Cybersecurity and Informatization of CAST, and supported by Science and Technology Review Publishing House