Effect of changing the proportion of C16:0 and <i>cis</i>-9 C18:1 in fat supplements on rumen fermentation, glucose and lipid metabolism, antioxidation capacity, and visceral fatty acid profile in finishing Angus bulls

Effect of changing the proportion of C16:0 and cis-9 C18:1 in fat supplements on rumen fermentation, glucose and lipid metabolism, antioxidation capacity, and visceral fatty acid profile in finishing Angus bulls

PDF

Haixin Bai^I, Lubo Wang^I, Modinat Tolani Lambo^I, Yang Li^I^,^*, Yonggen Zhang^I^,^*

Animal Nutrition | 2024, 18(1) : 39 - 48

Less

Animal Nutrition | 2024, 18(1): 39-48

• Original Research Article •

Full

Haixin Bai^I, Lubo Wang^I, Modinat Tolani Lambo^I, Yang Li^I^,^*, Yonggen Zhang^I^,^*

Affiliations

College of Animal Science and Technology, Northeast Agricultural University, Harbin 150030, China

Published: 2024-09-10 doi: 10.1016/j.aninu.2024.04.010

Outline

Abstract

Less

This study evaluated the effects of different proportions of palmitic (C16:0) and oleic (cis-9 C18:1) acids in fat supplements on rumen fermentation, glucose (GLU) and lipid metabolism, antioxidant function, and visceral fat fatty acid (FA) composition in Angus bulls. The design of the experiment was a randomized block design with 3 treatments of 10 animals each. A total of 30 finishing Angus bulls (21 ± 0.5 months) with an initial body weight of 626 ± 69 kg were blocked by weight into 10 blocks, with 3 bulls per block. The bulls in each block were randomly assigned to one of three experimental diets: (1) control diet without additional fat (CON), (2) CON + 2.5% palmitic calcium salt (PA; 90% C16:0), (3) CON + 2.5% mixed FA calcium salts (MA; 60% C16:0 + 30% cis-9 C18:1). Both fat supplements increased C18:0 and cis-9 C18:1 in visceral fat (P < 0.05) and up-regulated the expression of liver FA transport protein 5 (FATP5; P < 0.001). PA increased the insulin concentration (P < 0.001) and aspartate aminotransferase activity (AST; P = 0.030) in bull's blood while reducing the GLU concentration (P = 0.009). PA increased the content of triglycerides (TG; P = 0.014) in the liver, the content of the C16:0 in visceral fat (P = 0.004), and weight gain (P = 0.032), and up-regulated the expression of liver diacylglycerol acyltransferase 2 (DGAT2; P < 0.001) and stearoyl-CoA desaturase 1 (SCD1; P < 0.05). MA increased plasma superoxide dismutase activity (SOD; P = 0.011), reduced the concentration of acetate and total volatile FA (VFA) in rumen fluid (P < 0.05), and tended to increase plasma non-esterified FA (NEFA; P = 0.069) concentrations. Generally, high C16:0 fat supplementation increased weight gain in Angus bulls and triggered the risk of fatty liver, insulin resistance, and reduced antioxidant function. These adverse effects were alleviated by partially replacing C16:0 with cis-9 C18:1.

Key words

Palmitic acid / Oleic acid / Lipid metabolism / Lipotoxicity / Finishing bull

Cite this Article

Haixin Bai, Lubo Wang, Modinat Tolani Lambo, Yang Li, Yonggen Zhang. Effect of changing the proportion of C16:0 and cis-9 C18:1 in fat supplements on rumen fermentation, glucose and lipid metabolism, antioxidation capacity, and visceral fatty acid profile in finishing Angus bulls[J]. Animal Nutrition, 2024 , 18 (1) : 39 -48 . DOI: 10.1016/j.aninu.2024.04.010

Full Text

Less

1.　Introduction

Less

The efficiency of intramuscular fat deposition in beef cattle during the finishing period directly affects the marbling of beef (Ogata et al., 2019). Marbling is closely related to beef tenderness, juiciness and flavor, and is considered one of the most critical factors affecting beef quality (Lee et al., 2019). Increasing dietary energy concentration, such as supplementing fat, effectively increases intramuscular fat deposition (Park et al., 2018). However, individual fatty acids (FA) may have different fattening effects due to different preferential metabolic pathways of oxidative deposition. In lactating dairy cows, palmitic (C16:0) and oleic (cis-9 C18:1) acids are widely used to improve milk fat and body condition respectively because of their different effects (De Souza et al., 2018; Western et al., 2020). However, there are few reports on the difference between C16:0 and cis-9 C18:1 on the fattening performance of beef cattle. Previous experiments have shown that compared with cis-9 C18:1, more C16:0 improves beef cattle's growth performance and fat deposition (Bai et al., 2023). Dietary C16:0 and cis-9 C18:1 likely follow different oxidative deposition metabolic pathways in the body. Specifically, studies in rodents have shown that dietary saturated FA (SFA) reduce diet-induced thermogenesis by reducing sympathetic nerve activity in brown adipose tissue, thereby promoting fat accumulation in the body (Takeuchi et al., 1995). While ingested, unsaturated FA (UFA) oxidize faster and to a higher degree in the body, resulting in less weight gain (DeLany et al., 2000). However, whether C16:0 and cis-9 C18:1 affect beef cattle production through this differential metabolic regulation is not known.

In addition, when supplementing C16:0 as SFA, while effectively improving the weight gain of beef cattle, continuous intake is likely to lead to excessive obesity (Li et al., 2021). Ectopic fat deposition and adipose tissue expansion will release more non-esterified FA (NEFA; Palomer et al., 2018). Excessive blood NEFA and liver fat content have been shown to cause metabolic imbalances in dairy cows, leading to metabolic diseases such as ketosis, fatty liver, and insulin resistance (Hammon et al., 2009). However, medical studies have shown that cis-9 C18:1 can counteract or weaken the adverse effects of C16:0 by increasing insulin sensitivity and anti-inflammatory effects (Palomer et al., 2018). Therefore, we hypothesized that when partial cis-9 C18:1 is substituted for high C16:0 in fat supplements, the adverse effects of SFA C16:0 can be alleviated while maintaining high weight gain in beef cattle and ultimately maintaining body health.

Therefore, we adjusted the ratio of C16:0 to cis-9 C18:1 in fat supplements to evaluate the different effects of C16:0 and cis-9 C18:1 on weight gain and fat deposition in beef cattle due to their preferred metabolic pathways. At the same time, we assessed the effects of high C16:0 on glucose (GLU) and lipid metabolism homeostasis, plasma immune indices, and antioxidant function, as well as the alleviating effect of cis-9 C18:1 on the negative impact of C16:0.

2.　Materials and methods

Less

2.1.　 Animal ethics statement

All the procedures of this study were carried out following the guidelines approved by the Animal Ethics Committee of Northeast Agricultural University (Protocol number: NEAUEC2023 02 59). Animals were treated humanely in the process of feeding, slaughtering and sampling and this animal experiment complied with the ARRIVE guidelines.

2.2.　 Animals and experimental design

The design of the experiment was a randomized block design with 3 treatments of 10 animals each. A total of 30 finishing Angus bulls (21 ± 0.5 months) with an initial body weight of 626 ± 69 kg were blocked by weight into 10 blocks, with 3 bulls per block. The bulls in each block were randomly assigned to one of three experimental diets: (1) control diet without additional fat (CON), (2) CON + 2.5% palmitic calcium salt (PA; 90% C16:0), (3) CON + 2.5% mixed FA calcium salts (MA; 60% C16:0 + 30% cis-9 C18:1). Both fat supplements are rumen bypass fat. Diets were formulated based on the nutritional needs of this weight period according to NASEM (2016). The zeolite powder in CON was replaced by 2.5% dietary dry matter (DM) in the two fat treatments, and the other ingredients were the same, so the three diets were isoproteic and the PA and MA diets were isocaloric. The composition of diets and fat supplements is shown in Tables 1 and 2. Each bull was kept alone in a 4 m × 3 m pen, fed twice a day (08:00 and 17:00), and the feed amount was adjusted according to the feed intake of the previous day to get about 3% orts. All bulls could drink freely. The experiment lasted for 104 d following a 14-d preliminary feeding period.

2.3.　 Data and sample collection

2.3.1.　 Feed, body weight and blood

During the experiment, feed samples were collected once a week and stored at –20℃ until nutrient analysis. Daily orts were collected to determine dry matter intake (DMI). The bulls were weighed before morning feeding on d 0, 52, and 104 to determine weight changes. At the end of the experiment, blood samples were collected from the tail vein of all bulls before morning feeding and then centrifuged at 2,000 × g for 15 min at 4℃ to obtain plasma and stored at –20℃ until analysis.

2.3.2.　 Slaughter samples

After weighing and collecting blood on the 104 d, all bulls immediately were transported to an abattoir (Haosheng abattoir, Harbin, China) 15 km from the finishing farm for slaughter after fasting for 24 h. After slaughter, all the rumen contents of each bull were emptied into a plastic basin and mixed thoroughly. Approximately 500 g of the content was then collected and strained thorough 4 layers of cheesecloth to obtain a representative sample of rumen fluid. The rumen fluid pH was determined immediately with a pH meter (Mettler, METTLER TOLEDO Instrument Co., Ltd., Shanghai, China). One milliliter of metaphosphoric acid (25 %) was mixed with 5 mL rumen fluid and centrifuged at 3000 × g for 15 min. The supernatant was stored at –20℃ until volatile FA (VFA) was analyzed. Another 10 mL rumen fluid was mixed with 0.2 mL 50% sulfuric acid and stored at –20℃ to analyze ammonia nitrogen (NH₃–N). The liver was weighed, sampled, and stored at –80℃ for subsequent analysis. Ten grams of visceral fat around the kidneys of bulls was stored at –20℃ for FA profile analysis. Fifty grams of longissimus dorsi muscle between the 12th and 13th ribs of the left half carcass of each bull was stored at –20℃ for intramuscular protein and fat content analysis.

2.4.　 Laboratory analysis

2.4.1.　 Feed nutrients, intramuscular fat and protein, FA profile

Feed samples were dried at 55℃ for 72 h, then crushed and passed through a 1-mm sieve. The nutrients in the feed were determined according to AOAC (1990). In short, absolute DM was determined by oven-drying at 105℃ for 8 h. The nitrogen (N) content was measured by the Kjeldahl method, and the crude protein (CP) content was calculated by multiplying the N content by 6.25. The ash content was measured after combustion in a muffle furnace (SX2-12-10, Lichen Instrument Technology Co., Ltd, Shanghai, China) at 550℃ for 6 h. The ether extract (EE) content was determined by a Soxhlet apparatus (Ankom TX15, ANKOM Technology, Macedon, NY, USA). The acid detergent fiber (ADF) was determined gravimetrically as the residue remaining after extraction with an acid detergent solution. According to Van Soest et al. (1991), the content of neutral detergent fiber (NDF) in feed was determined by heat-stable α-amylase treatment. The total digestible nutrients (TDN), net energy for maintenance (NEm) and gain (NEg) of feed were calculated according to the NASEM (2016): DE (Mcal/kg DM) = TDN% × 4.409/100; ME (Mcal/kg DM) = DE × 0.82; NEm (Mcal/kg DM) = 1.37ME – 0.138ME² + 0.0105ME³ – 1.12; NEg (Mcal/kg DM) = 1.42ME – 0.174ME² + 0.0122ME³ – 1.65. The meat samples were freeze-dried in a freeze-dryer (Pilot2-4LD, Boyikang Laboratory Instrument Co., Ltd, Beijing, China) to determine DM, and the contents of CP and intramuscular fat were also determined by referring to AOAC (1990). The FA profile of feed, fat supplements and visceral adipose tissue were also analyzed according to the descriptions of Choi et al. (2013). In short, total lipids in 5 g of feed, 100 mg of FA supplements and 100 mg of adipose tissue were extracted with chloroform–methanol (2:1, vol/vol). Then, FA methyl ester (FAME) was prepared according to ISO 5009 (2001). C19:0 was the internal standard. FAME was analyzed by a gas chromatography-flame ionization detector (GC-2010 Plus autoinjector-AOC 20i; Shimadzu Scientific Instruments, Kyoto, Japan) equipped with a fused silica column (SP-2560, 100 m × 0.25 mm i.d. with 0.2-μm film thickness; Supelco Inc., Bellefonte, PA, USA). The initial temperature was 100℃ for 13 min, then it was heated to 180℃ at the rate of 10℃/min for 6 min, then to 200℃ at the rate of 1℃/min for 20 min, and finally to 230℃ at the rate of 4℃/min for 10.5 min. Nitrogen was the carrier gas, the shunt ratio was 100:1, and the injection volume was 1 μL. The FA composition of each sample was confirmed by comparing the retention time with the standards (FAME mix of 37 components from Supelco Inc., Bellefonte, PA, USA).

2.4.2.　 Ruminal fermentation

The VFA in rumen fluid was analyzed by gas chromatography (GC-8A; Shimadzu Corp., Kyoto, Japan), and the NH₃–N concentration was determined by the phenol-hypochlorite method as described by Li et al. (2023).

2.4.3.　 Plasma indices, liver triglycerides and cholesterol

The aspartate aminotransferase (AST), alanine aminotransferase (ALT), and GLU were detected by an automatic biochemical analyzer (model BS-800; Mindray Medical International Ltd., Shenzhen, China). The NEFA, β-hydroxybutyrate (BHB), total antioxidant capacity (T-AOC), superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), and malondialdehyde (MDA) were determined according to the instructions of the colorimetric kit (Jiancheng Bioengineering Research Institute, Nanjing, China). The plasma leptin and insulin were determined according to the standard operation of the ELISA kit (Beijing Sino-UK Institute of Biological Technology, Beijing, China). The liver's triglyceride (TG) content was determined according to the description of Kalaitzakis et al. (2010). First, the total lipids in the liver were extracted with chloroform–methanol solution (2:1, vol/vol), then saponified with 0.5 mol/L KOH and anhydrous ethanol at 70℃ for 60 min. Finally, an enzymatic assay kit (Jiancheng Bioengineering Research Institute, Nanjing, China) was used to determine the TG. The cholesterol in the liver was extracted and determined according to the method of Cong et al. (2012).

2.4.4.　 Real-time quantitative PCR analysis

The detailed operational steps of the mRNA transcriptional level analysis were reported in Shao et al. (2021). Briefly, Trizol reagent (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA from 100 mg liver tissue. The total RNA obtained was measured for concentration and purity using a Nanodrop 2000 ultramicro spectrophotometer (Thermo, America), and subsequent reverse transcription was performed based on this concentration. Reverse transcription of RNA into cDNA was done according to the instructions of the biosharp reverse transcription kit (BL699A, biosharp, Anhui, China). Based on the target gene sequence in GenBank, primers were designed using Primer Premier 6.0 software and synthesized by entrusting Sangon Biotech Co., Ltd. (Shanghai, China). The specific primer sequence information is shown in Table 3. Beta-actin was used as an internal reference gene. The instructions of 2× Fast qPCR Master Mixture (green) kit from Dining Company (Beijing, China) were followed strictly to prepare the real-time quantitative PCR reaction system and the reaction was performed in a fluorescence quantitative PCR instrument (Quantagene q225, Kubo, Beijing, China). At the end of the reaction, the amplification curve and fusion curve of the PCR were confirmed, and the gene mRNA expression level was calculated according to the 2^−ΔΔCt method, where ΔΔCt_{(sample-control)} = (Ct of target gene − Ct of β-actin)_sample – (Ct of target gene – Ct of β-actin)_control.

2.5.　 Statistical analysis

All data were analyzed using SAS 9.4 software (SAS Institute Inc., Cary, NC, USA). Because the randomized block design was used in this study, a mixed model considered the fat treatment as a fixed effect and the weight block as a random effect. The statistical model was as follows:

where Y_ij is the observation of bulls that belong to the jth weight block and were offered a diet containing the ith fat supplement, μ is the general mean, T_i is the fat supplements effect, B_j is the effect of weight block, and E_ij represents random residual error. The least squares means were calculated and separated using the default approach (PDIFF). Differences between fat diets were detected using Duncan's adjustment. Declared significant at P < 0.05, and trends were declared at 0.05 ≤ P < 0.10.

3.　Results

Less

3.1.　 Ruminal fermentation

As shown in Table 4, compared with CON, the two fat supplements did not affect rumen fluid pH and NH₃–N concentration (P > 0.05) but significantly reduced butyrate concentration (P = 0.009). Compared with CON and PA, the concentration of total VFA (P = 0.012) and acetate (P = 0.002) of the MA were significantly reduced and compared with CON and MA, the PA significantly increased the concentration of propionate (P = 0.005). In addition, other VFA (including isobutyrate, isovalerate, and valerate) and the ratio of acetate to propionate were not affected by PA and MA (P > 0.05).

3.2.　 Homeostasis of glucose and lipid metabolism

As shown in Table 5, there was no difference in plasma NEFA concentration between the two fat supplements and CON. However, compared to MA, the PA tended to increase plasma NEFA concentration (P = 0.069). Both fat supplements significantly increased plasma leptin concentration compared to CON (P < 0.001). Compared with CON, the PA significantly increased plasma AST activity (P = 0.030) and TG content in the liver (P = 0.014) of bulls; MA was not significant compared with CON and PA. In addition, fat supplementation had no significant effect on other lipid metabolism indexes in the blood and liver (P > 0.05).

PA significantly reduced fasting plasma GLU levels in bulls compared with CON and MA (P = 0.009). Compared with CON, the PA increased plasma insulin concentration (P < 0.001), while MA did not affect plasma insulin.

3.3.　 The mRNA relative expression of lipid metabolism genes in liver

As shown in Fig. 1, compared with CON, MA up-regulated the expression of the upstream regulatory factor PPARα for lipid synthesis in the liver (P = 0.014), and PA had no significant impact on PPARα. Compared with CON, both fat supplements up-regulated the expression of direct fat uptake gene FATP5 (P < 0.001). Compared with CON, PA significantly up-regulated SCD1 (P = 0.010), the key regulatory gene of FA desaturation, while MA was not different from CON and PA. Compared with CON and MA, PA significantly up-regulated the expression of the key gene DGAT2 for triglyceride synthesis in the liver (P < 0.001). In addition, fat supplementation did not significantly affect the expression of other lipid metabolism genes in the liver, such as C/EBPα, FASN, HMGCR and ATGL (P > 0.05).

3.4.　 Blood antioxidation

As shown in Table 6, there was no significant difference in activities of SOD between the two fat supplements and CON. However, compared with PA, MA significantly increased the SOD activity (P = 0.011). Compared with CON and MA, PA increased MDA content, a lipid peroxidation metabolite (P = 0.001). In addition, fat supplementation did not affect T-AOC (P = 0.101) and GSH-Px activity (P = 0.258).

3.5.　 Growth performance and meat quality

There was no significant difference in body weight among the bulls of the three groups at 0, 52, and 104 d (Table 7; P > 0.05). However, compared to CON, PA significantly increased the weight gain of bulls throughout the entire experimental period (P = 0.032), while MA showed no difference compared to CON and PA. There was no significant difference in DMI during the entire experimental period among the three diets (P = 0.274). Compared with CON, the two fat supplements did not affect the muscle protein (P = 0.577) and intramuscular fat (P = 0.100) content of longissimus dorsi muscle.

3.6.　 FA composition of visceral adipose tissue

Table 8 shows the composition of FA in visceral adipose with content greater than 0.1% of total FA. There was no significant difference in visceral fat C16:0 content between the two fat supplements compared with CON. But compared to MA, PA significantly increased the C16:0 content (P = 0.004). There were significant differences in C16:1, C18:3 n-3, and total n-3 FA (Σn-3 FA) content among the three diets (P < 0.001), as well as significant differences in the proportion of n-6 and n-3 FA (n-6/n-3 FA; P < 0.001). Compared with CON, the two fat supplements significantly increased C18:0 (P = 0.009), cis-9 C18:1 (P < 0.001), total UFA (ΣUFA; P < 0.001), and total monounsaturated FA (ΣMUFA; P < 0.001), while also increasing the ratio of ΣMUFA to ΣSFA (ΣMUFA/ΣSFA; P = 0.003). The content of total SFA (ΣSFA) in visceral fat was increased by PA, compared with CON and MA (P < 0.001). Compared to CON, MA increased the ratio of ΣUFA to ΣSFA (ΣUFA/ΣSFA; P = 0.003), while PA showed no difference compared to CON and MA.

4.　Discussion

Less

4.1.　 Ruminal fermentation

Due to the toxic effects of UFA on rumen microorganisms, which can reduce the rumen digestibility of fiber (Maia et al., 2007), cis-9 C18:1, cis-9, cis-12 C18:2, and C16:0 are usually complexed with calcium ions to form FA calcium salts (FA-Ca, a typical rumen bypass fat), aiming to minimize the adverse effects of rumen microbial fermentation (Rico et al., 2014). The results of this study are consistent with previous studies on finishing cattle and sheep in which when FA-Ca was supplemented at low levels (2% to 5% DM), rumen pH and NH₃–N were unaffected (He et al., 2018a; Behan et al., 2019). However, the FA-Ca characteristics of rumen protection make scholars neglect its effect on the rumen microorganism because FA-Ca is not completely inert in the rumen (He et al., 2018b). This may partly explain why rumen butyrate concentration decreased significantly after supplementation with FA-Ca (including PA and MA). In particular, MA containing 30% cis-9 C18:1 and 4% cis-9, cis-12 C18:2 significantly reduced acetate and total VFA. Unsaturated FA was shown to be more capable of lowering the rumen abundance of fibrolytic bacteria Butyrivibrio fibrisolvens, Fibrobacter succinogenes, Ruminococcus albus, Ruminococcus flavefaciens and Protozoa (Kholif et al., 2018), thus inhibiting the production of VFA. However, we observed that PA with more SFA increased propionate concentration. This is consistent with Behan et al. (2019), who found that a diet with more SFA (78% C16:0) increased propionate concentration in sheep compared to treatments with control and mixed FA (48% C16:0 + 41% cis-9 C18:1).

4.2.　 Homeostasis of glucose and lipid metabolism

Non-esterified FA in the blood comes from the intake of dietary FA or the decomposition of adipose tissue. In our results, PA had a tendency to increase NEFA compared to MA. This may be related to the difference in FA metabolism with different saturation. The saturation of ingested FA has been proven to affect its distribution between oxidation and storage in the body (Piers et al., 2003). Specifically, UFA such as cis-9 C18:1 and cis-9, cis-12 18:2 is oxidized faster than SFA such as C16:0 and C18:0 (Bergouignan et al., 2009) and C16:0 tends to be preferentially stored in tissues. This characteristic of C16:0 may keep the blood NEFA of PA treatment at continuously a high level. In addition, the cumulative positive balance of fat intake will lead to a large amount of body fat accumulation (Piers et al., 2002), including ectopic fat deposition in the liver; this is a critical cause of fatty liver. The increase in blood AST and liver TG under PA indicates that high C16:0 increases the burden on the liver and the risk of fatty liver disease in bulls. However, AST and TG returned to normal under MA with 30% cis-9 C18:1 and 4% cis-9, cis-12 C18:2 partially replacing C16:0. Consistent with our result, a study on rats showed that C16:0 incubated rat livers tend to use C16:0 for liver TG synthesis, while cis-9, cis-12 C18:2 incubated rat livers tend to be β-oxidized (Jones and Schoeller, 1988), suggesting that C16:0 is more likely than UFA to cause the liver to over-synthesize TG, resulting in fatty liver. Fatty liver in dairy cows has been reported extensively under the condition of negative energy balance in early lactation (Bobe et al., 2004). Cows with fatty liver also showed a commonality of elevated serum NEFA (Ohtsuka et al., 2001). This is consistent with our results stated above; that is, the plasma NEFA of bulls treated with PA increased with the increased risk of fatty liver. Leptin is an inhibitor secreted by fat cells that prevents excessive fat deposition. Both fat supplements increased leptin in the blood, which may mean that continuous dietary fat supplementation strongly activated leptin feedback regulation, maintaining lipid homeostasis by inhibiting fat production in peripheral tissues and increasing fat oxidation (Chilliard et al., 2005).

Unlike monogastric animals, which mainly absorb GLU through the intestines, ruminants only absorb about 10% of GLU through their intestines. Most of the circulating GLU comes from the liver gluconeogenesis of propionic acid, lactic acid and amino acids (De Koster and Opsomer, 2013). Therefore, when the liver function is damaged, it may affect gluconeogenesis in the ruminant liver. Studies on lactating cows have shown that the increase in liver fat content will interfere with the production capacity of GLU and lead to impairment of gluconeogenesis in the liver (Bobe et al., 2004). In our study, the decrease in fasting plasma GLU concentration in PA-treated bulls was most likely caused by impaired gluconeogenesis in the liver. As previously mentioned, the TG content in the bull's liver under this diet was significantly increased.

Studies on perinatal cows have shown a positive correlation between energy intake and insulin concentration (Gärtner et al., 2019). This effect was also observed in the PA group. However, MA with equal energy to PA did not affect insulin concentration. This led us to infer that not only the amount of fat intake but also fat saturation may affect insulin release. On the one hand, due to the metabolic difference between SFA and UFA mentioned above, bulls treated with PA have higher plasma NEFA and liver TG. These traits, representing obesity in bulls, easily result in insulin resistance, followed by hyperinsulinemia (De Koster and Opsomer, 2013; Czech, 2017). In addition, medical studies have shown that higher C16:0 supplementation will increase the production of harmful complex lipids diacylglycerol and ceramide in the body, thus damaging insulin signaling pathways and causing the development of insulin resistance (Holland et al., 2011). However, C16:0 substituted by cis-9 C18:1 can alleviate the adverse effects of C16:0 on insulin resistance and significantly improve insulin sensitivity (Palomer et al., 2018). In our study, MA with 30% cis-9 C18:1 is likely to mitigate the adverse effects of C16:0 through this mechanism, thereby maintaining normal fasting insulin levels. However, the specific mechanism still needs to be explored in future studies.

4.3.　 The mRNA relative expression of lipid metabolism genes in liver

Direct fat intake, de novo synthesis, storage and oxidative utilization are essential for maintaining liver fat balance (Flatt, 1995). The saturation of dietary fat affects lipid absorption and oxidation (Wang and Koo, 1993). From our results, high C16:0 significantly increased the likelihood of fatty liver disease in bulls, while cis-9 C18:1 alleviated this symptom. It may be that C16:0 and cis-9 C18:1 have different effects on liver lipid metabolism, so we measured liver-related genes. C/EBPα and PPARα are upstream transcriptional regulators of lipid synthesis. Compared with CON, the upregulation of PPARα under MA may be related to the cis-9 C18:1 in MA because cis-9 C18:1 has been proven to up-regulate the expression of PPARα (Belal et al., 2018). The expression of PPARα in the liver can up-regulate the key enzymes of FA oxidation and promote liver fat decomposition (Rogue et al., 2014). Both fat supplements up-regulated the expression of the FA direct uptake gene FATP5 but did not affect the expression of the FA de novo synthesis gene FASN. This may mean that extra dietary fat supplement strongly activates the mechanism of the liver to quickly clear blood NEFA through direct intake. The activation of this mechanism may not be related to individual FA but only related to total FA intake and blood flow. Diacylglycerol acyltransferase 2 is the key enzyme for the liver to synthesize TG (Xu et al., 2015). Although cis-9 C18:1 and C16:1 are the key substrates of liver TG synthesis (Xu et al., 2023), our results show that MA with 30% cis-9 C18:1 does not up-regulate the expression of DGAT2. In contrast, PA with high C16:0 up-regulated DGAT2. This may be due to the activation of desaturase activity by a large amount of C16:0 and C18:0 ingestion, which desaturated C16:0 and C18:0 into C16:1 and cis-9 C18:1, respectively. PA's significant upregulation of the SCD1 gene confirms this inference because SCD1 is the key enzyme that desaturates C16:0 and C18:0 into MUFA (Orrù et al., 2011). In addition, fat supplementation did not affect the liver cholesterol synthesis gene HMGCR and TG catabolism gene ATGL. In general, both forms of FA promote direct uptake of the liver. High C16:0 may be desaturated by SCD1 to MUFA as the substrate of DGAT2, resulting in more liver TG. On the other hand, cis-9 C18:1 promotes fat decomposition and avoids excessive accumulation of TG by up-regulating the expression of PPARα.

4.4.　 Blood antioxidation

Producing mitochondrial reactive oxygen species (ROS) can induce oxidative stress, which increases the possibility of systemic inflammation and insulin resistance in cattle (Palomer et al., 2018; Sordillo, 2013). Exposure of skeletal muscle cells to purified C16:0 significantly increases the production of ROS by mitochondria (Yuzefovych et al., 2010). Although ROS was not directly measured in our study, MDA was significantly increased in the PA group, which also indicated that the bull was in a state of oxidative stress induced by high C16:0 because MDA is considered to be the final stable product of ROS lipid peroxidation (Canakci et al., 2009). However, when cis-9 C18:1 was used to replace part of the C16:0 in PA, MA results showed that MDA in the blood was decreased, while the contents of SOD were increased. This means that supplementation of cis-9 C18:1 can reduce lipid peroxidation, improve antioxidant capacity, and protect the body from C16:0-induced oxidative stress (Nakamura et al., 2009). A study on obesity proves this point; that is, the antioxidant defense of cells is inhibited in the presence of C16:0, while cis-9 C18:1 supplementation restored this antioxidant mechanism (Sargsyan et al., 2016).

4.5.　 Growth performance and meat quality

When beef cattle (steer) are in the fattening stage of around 500 kg, fat accounts for over 50% of their weight gain (NASEM, 2016). The most abundant FA in beef cattle's adipose tissue and muscle were cis-9 C18:1, C16:0, C18:0, and cis-9, cis-12 C18:2 (Woods and Fearon, 2009). However, supplementing C16:0 and cis-9 C18:1 based on body composition may exhibit different priority metabolic pathways. Specifically, SFA C16:0 reduces diet-induced thermogenesis by lowering the sympathetic activity of brown adipose tissue, thereby promoting fat accumulation in the body (Takeuchi et al., 1995). The intake of cis-9 C18:1 can reduce fat deposition by increasing the β-oxygen of UFA (DeLany et al., 2000; Sanz et al., 2000). However, our study showed that both fat supplements did not significantly affect intramuscular fat content compared to CON. This shows that the primary impact target of metabolic difference between C16:0 and cis-9 C18:1 may be the other two fat depots, namely subcutaneous fat and visceral fat because these two fat depots are the primary deposition sites for fat (Schumacher et al., 2022). The bulls on the two fat-supplemented diets were fed diets equal in energy and nitrogen. The results showed that there was no difference in DMI during the whole trial period. Therefore, compared with CON, only PA increased the total weight gain, while MA was insignificant, which may be related to the difference in their FA composition. Because the oxidation rate of individual FA in fat intake can make a difference in weight gain, the weight gain of fast oxidizing cis-9 C18:1 was lower than that of SFA (DeLany et al., 2000; Mercer and Trayhurn, 1984). So, it could be the 30% cis-9 C18:1 in the MA that lowered the weight gain effect of C16:0 on beef cattle. However, this is only an inference based on a large number of medical and mouse research conclusions. How C16:0 and cis-9 C18:1 deeply affect ruminant animal fat deposition and weight gain needs further research.

4.6.　 FA composition of visceral adipose tissue

In the process of beef cattle growth, visceral fat is deposited first, followed by subcutaneous fat, and finally, muscle fat (Peng et al., 2021). The increase in visceral fat is related to the increase in portal vein NEFA (Smith et al., 2001). Therefore, the dietary intake of FA into the blood circulation is likely to be the first to affect the FA composition of visceral adipose tissue. In general, our results did prove this point, especially that PA significantly increased the C16:0 in the visceral adipose tissue of bulls. This is generally considered to be an adverse effect because increased SFA (especially C14:0 and C16:0) in animal products is thought to increase the risk of atherosclerosis in humans (Daley et al., 2010). Surprisingly, however, both fat supplements increased levels of C18:0, MUFA C16:1 and cis-9 C18:1. These FA are thought to be beneficial to human health (Kris-Etherton, 1999; Yu et al., 1995). Both fat supplements were mostly C16:0. This may mean that after dietary intake of abundant C16:0, the regulatory mechanism of adipose tissue is strongly activated, and C16:0 is deposited by lengthening and desaturating to C16:1, C18:0, cis-9 C18:1 (Moon et al., 2014). A key role in this process may be the SCD1 enzyme because several previous studies, including our results, showed that the activity of the SCD1 enzyme and mRNA expression was strongly activated in the presence of C16:0 (da Silva-Santi et al., 2016; Li et al., 2021).

Visceral tissue was taken from around the bull's kidney, as the fat in this area has been shown to continuously express uncoupling protein 1 (UCP1; a marker of brown fat; Komolka et al., 2017). Uncoupling protein 1 can induce adipose tissue to remove excess fat through thermogenesis and affect energy balance by regulating fat metabolism (Maliszewska and Kretowski, 2021). Saturated FA has been shown to reduce diet-induced thermogenesis by reducing sympathetic nerve activity and UCP1 expression in brown adipose tissue (Matsuo et al., 2002; Takeuchi et al., 1995), thereby promoting lipid accumulation in adipose tissue. Our results showed increased levels of C16:0, C18:0 and total SFA in adipose tissue treated with PA. It is likely that these elevated SFA promote the accumulation of body fat in bulls through this mechanism and ultimately increase their body weight.

5.　Conclusion

Less

High C16:0 fat supplementation increased weight gain in fattening bulls and carried the risk of fatty liver, insulin resistance, and reduced antioxidant function. These adverse effects were alleviated by replacing C16:0 with 30% cis-9 C18:1. However, some adverse effects of cis-9 C18:1 on rumen fermentation were observed. Therefore, there is a need for future work to investigate the optimal ratio of C16:0 and cis-9 C18:1 to maintain both increased weight gain and physical health in beef cattle.

References

Less

AOAC. Official methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analysis Chemists; 1990.

Bai

, Zhang

, Zhao

, Wang

, Zhang

, Lambo

, Zhang

, Li

, Wang

. Altering the ratio of palmitic, stearic, and oleic acids in dietary fat affects nutrient digestibility, plasma metabolites, growth performance, carcass, meat quality, and lipid metabolism gene expression of Angus bulls. Meat Sci 2023;199:109138. https://doi.org/10.1016/j.meatsci.2023.109138.

Behan

, Loh

, Fakurazi

, Kaka

, Samsudin

. Effects of supplementation of rumen protected fats on rumen ecology and digestibility of nutrients in sheep. Animals 2019;9(7):400. https://doi.org/10.3390/ani9070400.

Belal

, Sivakumar

, Kang

, Cho

, Choe

, Shim

. Modulatory effect of linoleic and oleic acid on cell proliferation and lipid metabolism gene expressions in primary bovine satellite cells. Anim Cells Syst 2018;22(5):324-33. https://doi.org/10.1080/19768354.2018.1517824.

Bergouignan

, Momken

, Schoeller

, Simon

, Blanc

. Metabolic fate of saturated and monounsaturated dietary fats: the Mediterranean diet revisited from epidemiological evidence to cellular mechanisms. Prog Lipid Res 2009;48(3-4):128-47. https://doi.org/10.1016/j.plipres.2009.02.004.

Bobe

, Young

, Beitz

. Invited review: pathology, etiology, prevention, and treatment of fatty liver in dairy cows. J Dairy Sci 2004;87(10):3105-24. https://doi.org/10.3168/jds.S0022-0302(04)73446-3.

Canakci

, Cicek

, Yildirim

, Sezer

, Canakci

. Increased levels of 8-hydroxydeoxyguanosine and malondialdehyde and its relationship with antioxidant enzymes in saliva of periodontitis patients. Eur J Dent 2009;3(2):100-6. https://doi.org/10.1055/s-0039-1697415.

Chilliard

, Delavaud

, Bonnet

. Leptin expression in ruminants: nutritional and physiological regulations in relation with energy metabolism. Domest Anim Endocrinol 2005;29(1):3-22. https://doi.org/10.1016/j.domaniend.2005.02.026.

Choi

, Gang

, Sawyer

, Johnson

, Kim

, Choi

, Smith

. Fatty acid biosynthesis and lipogenic enzyme activities in subcutaneous adipose tissue of feedlot steers fed supplementary palm oil or soybean oil. J Anim Sci 2013;91(5):2091-8. https://doi.org/10.2527/jas.2012-5801.

Cong

, Jia Y Li

, Ni

, Yang

, Sun

, Zhao

. Maternal low-protein diet causes epigenetic deregulation of HMGCR and CYP7α1 in the liver of weaning piglets. J Nutr Biochem 2012;23(12):1647-54. https://doi.org/10.1016/j.jnutbio.2011.11.007.

Czech

. Insulin action and resistance in obesity and type 2 diabetes. Nat Med 2017;23(7):804-14. https://doi.org/10.1038/nm.4350.

Daley

, Abbott

, Doyle

, Nader

, Larson

. A review of fatty acid profiles and antioxidant content in grass-fed and grain-fed beef. Nutr J 2010;9(1):1-12. https://doi.org/10.1186/1475-2891-9-10.

da Silva-Santi

, Antunes

, Caparroz-Assef

, Carbonera

, Masi

, Curi

, Bazotte

. Liver fatty acid composition and inflammation in mice fed with high-carbohydrate diet or high-fat diet. Nutrients 2016;8(11):682. https://doi.org/10.3390/nu8110682.

De Koster

, Opsomer

. Insulin resistance in dairy cows. Vet Clin N Am Food Anim 2013;29(2):299-322. https://doi.org/10.1016/j.cvfa.2013.04.002.

DeLany

, Windhauser

, Champagne

, Bray

. Differential oxidation of individual dietary fatty acids in humans. Am J Clin Nutr 2000;72(4):905-11. https://doi.org/10.1093/ajcn/72.4.905.

De Souza

, Preseault

, Lock

. Altering the ratio of dietary palmitic, stearic, and oleic acids in diets with or without whole cottonseed affects nutrient digestibility, energy partitioning, and production responses of dairy cows. J Dairy Sci 2018;101(1):172-85. https://doi.org/10.3168/jds.2017-13460.

Flatt

. Use and storage of carbohydrate and fat. Am J Clin Nutr 1995;61(4):952S-9S. https://doi.org/10.1093/ajcn/61.4.952S.

Gärtner

, Gernand

, Gottschalk

, Donat

. Relationships between body condition, body condition loss, and serum metabolites during the transition period in primiparous and multiparous cows. J Dairy Sci 2019;102(10):9187-99. https://doi.org/10.3168/jds.2018-15762.

Hammon

, Stürmer

, Schneider

, Tuchscherer

, Blum

, Engelhard

, Kanitz

. Performance and metabolic and endocrine changes with emphasis on glucose metabolism in high-yielding dairy cows with high and low fat content in liver after calving. J Dairy Sci 2009;92(4):1554-66. https://doi.org/10.3168/jds.2008-1634.

, Niu

, Qiu

, Xia

, Shao

, Wang

, Cao

. Effect of calcium salt of long-chain fatty acids and alfalfa supplementation on performance of Holstein bulls. Oncotarget 2018a;9(3):3029. https://doi.org/10.18632/oncotarget.23073.

, Yu

, Qiu

, Shao

, Niu

, Xia

, Cao

. Effects of dietary protein levels and calcium salts of long-chain fatty acids on nitrogen mobilization, rumen microbiota and plasma fatty acid composition in Holstein bulls. Anim Feed Sci Technol 2018b;246:1-10. https://doi.org/10.1016/j.anifeedsci.2018.09.019.

Holland

, Bikman

, Wang

, Yuguang

, Sargent

, Bulchand

, Summers

. Lipid-induced insulin resistance mediated by the proinflammatory receptor TLR4 requires saturated fatty acid-induced ceramide biosynthesis in mice. J Clin Investig 2011;121(5):1858-70. https://doi.org/10.1172/JCI43378.

NASEM (National Academies of Science, Engineering and Medicine). Nutrient requirements of beef cattle. 8th ed. Washington (DC): National Academies Press; 2016.

ISO 5509. Animal and vegetable fats and oils. Preparation of methyl esters of fatty acids. Prague (Czech Rep.): Czech Standards Institute; 2001.

Jones

, Schoeller

. Polyunsaturated: saturated ratio of diet fat influences energy substrate utilization in the human. Metabolism 1988;37(2):145-51. https://doi.org/10.1016/S0026-0495(98)90009-9.

Kalaitzakis

, Panousis

, Roubies

, Giadinis

, Kaldrymidou

, Georgiadis

, Karatzias

. Clinicopathological evaluation of downer dairy cows with fatty liver. Can Vet J 2010;51(6):615. https://doi.org/10.1186/1746-6148-6-29.

Kholif

, Morsy

, Abdo

. Crushed flaxseed versus flaxseed oil in the diets of Nubian goats: effect on feed intake, digestion, ruminal fermentation, blood chemistry, milk production, milk composition and milk fatty acid profile. Anim Feed Sci Technol 2018;244:66-75. https://doi.org/10.1016/j.anifeedsci.2018.08.003.

Komolka

, Albrecht

, Gotoh

, Maak

. Abundance of beige and brown adipocyte markers in different adipose depots of cattle at 26 months of age. Adv in Anim Biosci 2017;8(s1):s38-41. https://doi.org/10.1017/S2040470017001662.

Kris-Etherton

. Monounsaturated fatty acids and risk of cardiovascular disease. Circulation 1999;100(11):1253-8. https://doi.org/10.1161/01.CIR.100.11.1253.

Lee

, Yoon

, Choi

. Comparison of marbling fleck characteristics between beef marbling grades and its effect on sensory quality characteristics in high-marbled Hanwoo steer. Meat Sci 2019;152:109-15. https://doi.org/10.1016/j.meatsci.2019.02.019.

, Cao

, Zheng

, Yang

, Tan

, Xu

, Liu

. Palm oil consumption and its repercussion on endogenous fatty acids distribution. Food Funct 2021;12(5):2020-31. https://doi.org/10.1039/D0FO02511A.

, Gao

, Lv

, Lambo

, Wang

, Zhang

. Replacing soybean meal with high-oil pumpkin seed cake in the diet of lactating Holstein dairy cows modulated rumen bacteria and milk fatty acid profile. J Dairy Sci 2023;106(3):1803-14. https://doi.org/10.3168/jds.2022-22503.

Maia

, Chaudhary

, Figueres

, Wallace

. Metabolism of polyunsaturated fatty acids and their toxicity to the microflora of the rumen. Anton Leeuw 2007;91:303-14. https://doi.org/10.1007/s10482-006-9118-2.

Maliszewska

, Kretowski

. Brown adipose tissue and its role in insulin and glucose homeostasis. Int J Mol Sci 2021;22(4):1530. https://doi.org/10.3390/ijms22041530.

Matsuo

, Takeuchi

, Suzuki

. Body fat accumulation is greater in rats fed a beef tallow diet than in rats fed a safflower or soybean oil diet. Asia Pac J Clin Nutr 2002;11(4):302-8. https://doi.org/10.1046/j.1440-6047.2002.00299.x.

Mercer

, Trayhurn

. Effect of high fat diets on the thermogenic activity of brown adipose tissue in cold-acclimated mice. J Nutr 1984;114(6):1151-8. https://doi.org/10.1093/jn/114.6.1151.

Moon

, Ochoa

, Mitsche

, Hammer

, Horton

. Deletion of ELOVL6 blocks the synthesis of oleic acid but does not prevent the development of fatty liver or insulin resistance. J Lipid Res 2014;55(12):2597-605. https://doi.org/10.1194/jlr.M054353.

Nakamura

, Takamura

, Matsuzawa-Nagata

, Takayama

, Misu

, Noda

, Kaneko

. Palmitate induces insulin resistance in H4IIEC3 hepatocytes through reactive oxygen species produced by mitochondria. J Biol Chem 2009;284(22):14809-18. https://doi.org/10.1074/jbc.M901488200.

Ogata

, Makino

, Ishizuka

, Iwamoto

, Masaki

, Ikuta

, Sato

. Long-term high-grain diet altered the ruminal pH, fermentation, and composition and functions of the rumen bacterial community, leading to enhanced lactic acid production in Japanese Black beef cattle during fattening. PLoS One 2019;14(11):e0225448. https://doi.org/10.1371/journal.pone.0225448.

Ohtsuka

, Koiwa

, Hatsugaya

, Kudo

, Hoshi

, Itoh

, Kawamura

. Relationship between serum TNF activity and insulin resistance in dairy cows affected with naturally occurring fatty liver. J Vet Med Sci 2001;63(9):1021-5. https://doi.org/10.1292/jvms.63.1021.

Orrù

, Cifuni

, Piasentier

, Corazzin

, Bovolenta

, Moioli

. Association analyses of single nucleotide polymorphisms in the LEP and SCD1 genes on the fatty acid profile of muscle fat in Simmental bulls. Meat Sci 2011;87(4):344-8. https://doi.org/10.1016/j.meatsci.2010.11.009.

Palomer

, Pizarro-Delgado

, Barroso

, Vázquez-Carrera

. Palmitic and oleic acid: the yin and yang of fatty acids in type 2 diabetes mellitus. Trends Endocrin Met 2018;29(3):178-90. https://doi.org/10.1016/j.tem.2017.11.009.

Park

, Beak

, Kim

, Jeong

, Piao

, Kang

, Baik

. Genetic, management, and nutritional factors affecting intramuscular fat deposition in beef cattle—a review. Asian Austral J Anim 2018;31(7):1043. https://doi.org/10.5713/ajas.18.0310.

Peng

, Smith

, Lee

. Vitamin A regulates intramuscular adipose tissue and muscle development: promoting high-quality beef production. J Anim Sci Biotechnol 2021;12(1):34. https://doi.org/10.1186/s40104-021-00558-2.

Piers

, Walker

, Stoney

, Soares

, O'Dea

. The influence of the type of dietary fat on postprandial fat oxidation rates: monounsaturated (olive oil) vs saturated fat (cream). Int J Obes 2002;26:814-21. https://doi.org/10.1038/sj.ijo.0801993.

Piers

, Walker

, Stoney

, Soares

, O'Dea

. Substitution of saturated with monounsaturated fat in a 4-week diet affects body weight and composition of overweight and obese men. Brit J Nutr 2003;90(3):717-27. https://doi.org/10.1079/BJN2003948.

Rico

, Ying

, Harvatine

. Effect of a high-palmitic acid fat supplement on milk production and apparent total-tract digestibility in high-and low-milk yield dairy cows. J Dairy Sci 2014;97(6):3739-51. https://doi.org/10.3168/jds.2013-7341.

Rogue

, Anthérieu

, Vluggens

, Umbdenstock

, Claude

, De La Moureyre-Spire

, Guillouzo

. PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells. Toxicol Appl Pharm 2014;276(1):73-81. https://doi.org/10.1016/j.taap.2014.02.001.

Sanz

, Lopez-Bote

, Menoyo

, Bautista

. Abdominal fat deposition and fatty acid synthesis are lower and β-oxidation is higher in broiler chickens fed diets containing unsaturated rather than saturated fat. J Nutr 2000;130(12):3034-7. https://doi.org/10.1093/jn/130.12.3034.

Sargsyan

, Artemenko

, Manukyan

, Bergquist

, Bergsten

. Oleate protects betacells from the toxic effect of palmitate by activating pro-survival pathways of the ER stress response. BBA Mol Cell Biol Lipids 2016;1861(9):1151-60. https://doi.org/10.1016/j.bbalip.2016.06.012.

Schumacher

, DelCurto-Wyffels

, Thomson

, Boles

. Fat deposition and fat effects on meat quality—a review. Animals 2022;12(12):1550. https://doi.org/10.3390/ani12121550.

Shao

, Ireland

, McCann

, Shike

. Effects of supplements differing in fatty acid profile to late gestational beef cows on cow performance, calf growth performance, and mRNA expression of genes associated with myogenesis and adipogenesis. J Anim Sci Biotechnol 2021;12(1):1-15. https://doi.org/10.1186/s40104-021-00588-w.

Smith

, Lovejoy

, Greenway

, Ryan

, deJonge

, de la Bretonne

, Bray

. Contributions of total body fat, abdominal subcutaneous adipose tissue compartments, and visceral adipose tissue to the metabolic complications of obesity. Metabolism 2001;50(4):425-35. https://doi.org/10.1053/meta.2001.21693.

Sordillo

. Selenium-dependent regulation of oxidative stress and immunity in periparturient dairy cattle. Vet Med Int 2013;2013:8. https://doi.org/10.1155/2013/154045.

Takeuchi

, Matsuo

, Tokuyama

, Shimomura

, Suzuki

. Diet-induced thermogenesis is lower in rats fed a lard diet than in those fed a high oleic acid safflower oil diet, a safflower oil diet or a linseed oil diet. J Nutr 1995;125(4):908-19. https://doi.org/10.1093/jn/125.4.920.

Van Soest

, Robertson

, Lewis

. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci 1991;74(10):3583-97. https://doi.org/10.3168/jds.S0022-0302(91)78551-2.

Wang

, Koo

. Evidence for distinct metabolic utilization of stearic acid in comparison with palmitic and oleic acids in rats. J Nutr Biochem 1993;4(10):594-601. https://doi.org/10.1016/0955-2863(93)90028-U.

Western

, de Souza

, Lock

. Milk production responses to altering the dietary ratio of palmitic and oleic acids varies with production level in dairy cows. J Dairy Sci 2020;103(12):11472-82. https://doi.org/10.3168/jds.2020-18936.

Woods

, Fearon

. Dietary sources of unsaturated fatty acids for animals and their transfer into meat, milk and eggs: a review. Livest Sci 2009;126(1-3):1-20. https://doi.org/10.1016/j.livsci.2009.07.002.

, Li

, Wang

, Chen

, Wang

, Song

, Sun

. Depletion of stearoyl-CoA desaturase (SCD) leads to fatty liver disease and defective mating behavior in zebrafish. Zool Res 2023;44(1):63. https://doi.org/10.24272/j.issn.2095-8137.2022.167.

, Tao

, Chang

, Zhang

, Xu

, Shen

. Lipopolysaccharide derived from the rumen down-regulates stearoyl-CoA desaturase 1 expression and alters fatty acid composition in the liver of dairy cows fed a high-concentrate diet. BMC Vet Res 2015;11:1-11. https://doi.org/10.1186/s12917-015-0360-6.

Yuzefovych

, Wilson

, Rachek

. Different effects of oleate vs. palmitate on mitochondrial function, apoptosis, and insulin signaling in L6 skeletal muscle cells: role of oxidative stress. Am J Physiol Endocrinol Metab 2010;299(6):E1096-105. https://doi.org/10.1152/ajpendo.00238.2010.

, Derr

, Etherton

, Kris-Etherton

. Plasma cholesterol-predictive equations demonstrate that stearic acid is neutral and monounsaturated fatty acids are hypocholesterolemic. Am J Clin Nutr 1995;61(5):1129-39. https://doi.org/10.1093/ajcn/61.5.1129.

Appendix

Less

Year 2024 volume 18 Issue 1

PDF

Cite this Article

BibTeX

Article Info

doi: 10.1016/j.aninu.2024.04.010

Receive Date：2023-09-27
Online Date：2026-01-28
Published：2024-09-10

Article Data

Affiliations

History

Received：2023-09-27
Revised：2024-03-29
Accepted：2024-04-16

Affiliations

College of Animal Science and Technology, Northeast Agricultural University, Harbin 150030, China

Corresponding:

Corresponding authors. E-mail addresses: liyang1405053@neau.edu.cn (Y. Li)

zhangyonggen@neau.edu.cn (Y. Zhang).

References

Share

https://castjournals.cast.org.cn/joweb/aninu/EN/10.1016/j.aninu.2024.04.010

Share to

Scan QR to access full text

Cite this article

BibTeX

Citations

表12种不同金属材料的力学参数

科 Family	属数 Number of genus	种数 Number of species	占总种数比例 Percentage of total species (%)	属 Genus	种数 Number of species	占总种数比例 Percentage of total species (%)
鹅膏菌科Amanitaceae	2	11	5.26	鹅膏菌属 Amanita	10	4.78
小菇科 Mycenaceae	2	12	5.74	丝盖伞属 Inocybe	5	2.39
多孔菌科 Polyporaceae	8	14	6.70	蜡蘑属 Laccaria	5	2.39
红菇科 Russulaceae	3	23	11.00	小皮伞属 Marasmius	6	2.87
				小菇属 Mycena	11	5.26
				光柄菇属 Pluteus	5	2.39
				红菇属 Russula	17	8.13
				栓菌属 Trametes	5	2.39

关闭全屏

BibTeX
EndNote
RefWorks
TxT

Table 1 Ingredients and nutrient composition of treatment diets (% of DM).

Item	Diet¹
Item	CON	PA	MA
Ingredients
Corn grain	45.00	45.00	45.00
Soybean meal	8.50	8.50	8.50
Distillers dried grains with solubles	5.00	5.00	5.00
Corn germ meal	5.50	5.50	5.50
Limestone	1.00	1.00	1.00
Salt (sodium chloride)	0.80	0.80	0.80
Sodium bicarbonate	1.10	1.10	1.10
Mineral-vitamin premix²	0.40	0.40	0.40
Magnesium oxide	0.20	0.20	0.20
Peanut hulls	15.00	15.00	15.00
Corn stalk	15.00	15.00	15.00
Zeolite powder	2.50	–	–
Palmitic calcium salt	–	2.50	–
Mixed FA calcium salt	–	–	2.50
Nutrient composition³
CP	11.56	11.59	11.53
EE	3.74	6.25	6.23
NDF	34.28	34.30	34.28
ADF	20.32	20.36	20.36
Ash	7.97	7.27	7.29
NEm, Mcal/kg	1.76	1.83	1.82
NEg, Mcal/kg	1.15	1.20	1.19
Fatty acids, g/100 g DM
C16:0	1.47	3.76	2.95
C18:0	0.38	0.65	0.47
cis-9 C18:1	1.15	1.18	1.91
cis-9, cis-12C18:2	0.46	0.52	0.68

CP = crude protein; EE = ether extract; NDF = neutral detergent fiber; ADF = acid detergent fiber; NEm = net energy for maintenance; NEg = net energy for gain. ¹ CON, control diet without additional fat; PA, CON + 2.5% DM palmitic calcium salt (90% C16:0); MA, CON + 2.5% DM mixed fatty acid calcium salt (60% C16:0 + 30% cis-9 C18:1). ² The mineral-vitamin premix provided the following per kilogram of the diet: vitamin A 6,000 IU, vitamin D 600 IU, vitamin E 50 IU, Fe 50 mg, Cu 15 mg, Mn 27 mg, Zn 65 mg, Se 0.1 mg, I 0.5 mg, Co 0.2 mg. ³ NEm and NEg levels were estimated according to NASEM (2016), and the rest of the nutrient levels were measured.

Table 2 Composition of fat supplements (% of total fatty acids).

Item	Fat supplement¹
Item	Palmitic calcium salt	Mixed FA calcium salt
SFA
C16:0	90.36	60.45
C18:0	6.78	2.93
Total SFA	97.14	63.38
MUFA
cis-9 C18:1	1.62	30.87
PUFA
cis-9, cis-12 C18:2	1.07	3.86
Total UFA	2.69	34.73
Others²	0.17	1.89

SFA = saturated fatty acids, MUFA = monounsaturated fatty acids, PUFA = polyunsaturated fatty acids, UFA = unsaturated fatty acids. ¹ After the two kinds of fat supplements were designed, Sanhe Feed Co., Ltd. (Hei Longjiang, China) was entrusted to produce them. ² Others included C14:0, C20:0, C16:1, and C18:3 n-3.

Table 3 Real-time quantitative PCR primer sequences.

Genes	Primers	Sequences (5′ to 3′)	Product size, bp	GenBank accession No.
C/EBPα	Forward	TGGACAAGAACAGCAACGAG	133	NM_176784
C/EBPα	Reverse	TCATTGTCACTGGTCAGCTC
PPARα	Forward	CAATGGAGATGGTGGACACA	95	NM_001034036.1
PPARα	Reverse	TTGTAGGAAGTCTGCCGAGAG
FATP5	Forward	GCATGGTGTGACTGTGATCC	141	NM_001033625
FATP5	Reverse	TGGAAGGTCTCCCACACTTC
FASN	Forward	ATCGAGTGCATCAGGCAAGT	92	NM_001012669
FASN	Reverse	TGTGAGCACATCTCGAAAGCC
SCD1	Forward	TTATTCCGTTATGCCCTTGG	83	NM_173959
SCD1	Reverse	TTGTCATAAGGGCGGTATCC
DGAT2	Forward	CATTGCCGTGCTCTACTTCA	86	NM_205793.2
DGAT2	Reverse	AGTTTCGGACCCACTGTGAC
HMGCR	Forward	CGCAACCTTTACATCCGTTT	117	NM_001105613
HMGCR	Reverse	GTGCATTTCGGGGAAATACTC
ATGL	Forward	TGACCACACTCTCCAACA	100	NM_001046005
ATGL	Reverse	AAGCGGATGGTGAAGGA
Beta-actin	Forward	AGCAAGCAGGAGTACGATGAGT	120	NM_173979
Beta-actin	Reverse	ATCCAACCGACTGCTGTCA

C/EBPα = CCAAT/enhancer binding protein α; PPARα = peroxisome proliferator-activated receptor α; FATP5 = fatty acid transport protein 5; FASN = fatty acid synthase; SCD1 = stearoyl-CoA desaturase 1; DGAT2 = diacylglycerol acyltransferase 2; HMGCR = 3-hydroxy-3-methylglutaryl-CoA reductase; ATGL = adipose triglyceride lipase.

Table 4 Effects of fat supplements with different fatty acids (FA) on rumen fermentation in Angus bulls.

Item	Treatment¹			SEM	P-value
Item	CON	PA	MA	SEM	P-value
pH	6.53	6.50	6.48	0.076	0.897
NH₃–N, mg/dL	7.81	8.32	7.98	0.454	0.719
Total VFA, mmol/L	52.24^a	53.28^a	47.94^b	1.242	0.012
Individual VFA, mmol/L
Acetate	28.37^a	29.34^a	24.64^b	0.897	0.002
Propionate	9.38^b	10.18^a	8.83^b	0.268	0.005
Isobutyrate	0.84	0.89	0.88	0.033	0.476
Butyrate	4.53^a	3.40^b	3.47^b	0.265	0.009
Isovalerate	1.60	1.79	1.61	0.083	0.202
Valerate	0.19	0.24	0.21	0.020	0.283
Acetate/propionate	3.03	2.88	2.84	0.111	0.463

NH₃–N = ammonia nitrogen; Total VFA = total volatile fatty acid. ^{a, b}Means within rows with different superscripts differ (P < 0.05). ¹ CON, control diet without additional fat; PA, CON + 2.5% DM palmitic calcium salt (90% C16:0); MA, CON + 2.5% DM mixed fatty acid calcium salt (60% C16:0 + 30% cis-9 C18:1).

Table 5 Effects of fat supplements with different fatty acids (FA) on the homeostasis of glucose and lipid metabolism of finishing Angus bulls.

Item	Treatment¹			SEM	P-value
Item	CON	PA	MA	SEM	P-value
Plasma index
NEFA, mmol/L	0.14	0.16	0.13	0.009	0.069
BHB, mmol/L	0.24	0.23	0.22	0.007	0.377
Leptin, ng/mL	5.37^b	6.31^a	6.29^a	0.166	<0.001
AST, U/L	70.06^b	75.86^a	72.41^ab	1.456	0.030
ALT, U/L	30.52	31.44	27.12	1.665	0.173
AST/ALT	2.35	2.53	2.68	0.135	0.245
GLU, mmol/L	3.92^a	3.49^b	3.85^a	0.097	0.009
Insulin, μIU/mL	13.16^b	14.65^a	13.26^b	0.232	<0.001
Liver index
Liver weight, kg	7.19	7.42	7.16	0.258	0.737
TG, mmol/g	0.11^b	0.13^a	0.12^ab	0.005	0.014
Cholesterol, mmol/g	0.031	0.028	0.029	0.002	0.403

NEFA = non-esterified fatty acid; BHB = β-hydroxybutyrate; AST = aspartate aminotransferase; ALT = alanine aminotransferase; GLU = glucose; TG = triglycerides. ^a,bWithin a row, values with different superscripts differ significantly at P < 0.05, a trend at P < 0.1. ¹ CON, control diet without additional fat; PA, CON + 2.5% DM palmitic calcium salt (90% C16:0); MA, CON + 2.5% DM mixed FA calcium salt (60% C16:0 + 30% cis-9 C18:1).

Table 6 Effects of fat supplements with different fatty acids (FA) on blood antioxidation in finishing Angus bulls.

Item	Treatment¹			SEM	P-value
Item	CON	PA	MA	SEM	P-value
T-AOC, U/mL	2.81	2.65	2.89	0.078	0.101
GSH-Px, U/mL	134.94	133.51	129.03	2.578	0.258
SOD, U/mL	94.18^ab	92.41^b	96.56^a	0.903	0.011
MDA, nmol/mL	3.43^b	3.98^a	3.68^b	0.094	0.001

T-AOC = total antioxidant capacity; GSH-Px = glutathione peroxidase; SOD = superoxide dismutase; MDA = malondialdehyde. ^{a, b}Means within rows with different superscripts differ (P < 0.05). ¹ CON, control diet without additional fat; PA, CON + 2.5% DM palmitic calcium salt (90% C16:0); MA, CON + 2.5% DM mixed FA calcium salt (60% C16:0 + 30% cis-9 C18:1).

Table 7 Effects of fat supplements with different fatty acids (FA) on growth performance and meat quality of finishing Angus bulls.

Item	Treatment¹			SEM	P-value
Item	CON	PA	MA	SEM	P-value
Growth performance
DMI, kg/d	12.08	12.46	12.07	0.190	0.274
Initial weight, kg	627.12	623.68	628.69	22.194	0.987
Weight at 52 d, kg	693.53	710.36	700.19	20.447	0.843
Weight at 104 d, kg	753.7	787.4	773.75	17.284	0.395
Weight gain (0 to 104 d), kg	126.58^b	163.72^a	145.06^ab	9.359	0.032
Meat quality
Muscle protein, %	19.34	19.65	19.89	0.367	0.577
Intramuscular fat, %	6.81	7.40	7.39	0.218	0.100

DMI = dry matter intake. ^{a, b}Means within rows with different superscripts differ (P < 0.05). ¹ CON, control diet without additional fat; PA, CON + 2.5% DM palmitic calcium salt (90% C16:0); MA, CON + 2.5% DM mixed FA calcium salt (60% C16:0 + 30% cis-9 C18:1).

Table 8 Effects of fat supplements with different fatty acids (FA) on the FA profile of visceral adipose tissue of finishing Angus bulls (% of total FA).

Item	Treatment¹			SEM	P-value
Item	CON	PA	MA	SEM	P-value
C14:0	2.97	3.13	2.96	0.073	0.207
C14:1	0.17	0.18	0.19	0.014	0.632
C15:0	0.40	0.41	0.39	0.010	0.567
C16:0	31.68^ab	32.56^a	30.81^b	0.334	0.004
C16:1	1.79^c	2.04^a	1.91^b	0.041	<0.001
C17:0	0.87	0.87	0.86	0.008	0.530
C17:1	0.35	0.33	0.35	0.009	0.717
C18:0	28.04^b	30.42^a	29.72^a	0.512	0.009
cis-9 C18:1	25.55^b	28.84^a	29.04^a	0.445	<0.001
C18:2 n-6c²	1.67	1.64	1.69	0.056	0.810
C18:2 n-6t³	0.19	0.18	0.19	0.004	0.891
C18:3 n-3⁴	0.19^b	0.16^c	0.22^a	0.006	<0.001
C20:0	0.25	0.26	0.24	0.006	0.319
C21:0	0.36	0.35	0.36	0.010	0.810
ΣSFA⁵	64.57^b	67.99^a	65.34^b	0.593	<0.001
ΣUFA⁶	29.90^b	33.39^a	33.57^a	0.477	<0.001
ΣMUFA⁷	27.86^b	31.40^a	31.48^a	0.485	<0.001
ΣPUFA⁸	2.05	1.98	2.09	0.059	0.460
Σn-3 FA	0.19^b	0.16^c	0.22^a	0.006	<0.001
Σn-6 FA⁹	1.86	1.82	1.87	0.056	0.793
n-6/n-3 FA	10.00^b	11.13^a	8.71^c	0.336	<0.001
ΣMUFA/ΣSFA	0.43^b	0.46^a	0.48^a	0.010	0.003
ΣPUFA/ΣSFA	0.032	0.029	0.032	0.001	0.067
ΣUFA/ΣSFA	0.46^b	0.49^ab	0.52^a	0.010	0.003

SFA = saturated fatty acids; UFA = unsaturated fatty acids; MUFA = monounsaturated fatty acids; PUFA = polyunsaturated fatty acids; Σn-3 FA = total n-3 fatty acids. Fatty acids detected at < 0.1 % of total fatty acid are not reported. ^a,b,cMeans within rows with different superscripts differ (P < 0.05). ¹ CON, control diet without additional fat; PA, CON + 2.5% DM palmitic calcium salt (90% C16:0); MA, CON + 2.5% DM mixed FA calcium salt (60% C16:0 + 30% cis-9 C18:1). ² C18:2 n-6c = cis-9, cis-12 C18:2. ³ C18:2 n-6t = cis-9, trans-11 C18:2. ⁴ C18:3 n-3 = cis-9, cis-12, cis-15 C18:3. ⁵ ΣSFA = C14:0 + C15:0 + C16:0 + C17:0 + C18:0 + C20:0 + C21:0. ⁶ ΣUFA = C14:1 + C16:1 + C17:1 + cis-9 C18:1 + C18:2n-6c + C18:2n-6t + C18:3n-3. ⁷ ΣMUFA = C14:1 + C16:1 + C17:1 + cis-9 C18:1. ⁸ ΣPUFA = C18:2n-6c + C18:2n-6t + C18:3n-3. ⁹ Σn-6 FA = C18:2n-6c + C18:2n-6t.

Articles: Latest Articles; Most Read; Collections

Updates: Events; News; Multimedia

About: About Us

Contact

No. 86 Xueyuan South Road, Haidian District, Beijing

100081

010-62199257

qkjq@cast.org.cn

Copyright © 2025 China Association for Science and Technology. All rights reserved. For all open access content, the relevant licensing terms apply.
Sponsored by the Office of the Leading Group for Cybersecurity and Informatization of CAST, and supported by Science and Technology Review Publishing House