Home Journals Articles Updates About
CN
image
收藏切换
Hexokinase 1 and 2 mediates glucose utilization to regulate the synthesis of kappa casein via ribosome protein subunit 6 kinase 1 in bovine mammary epithelial cells
收藏切换
PDF
Tianyu YangI, Jia GuoI, Han SongI, Osmond DatsomorI, Yuhang ChenI, Maocheng JiangI, Kang ZhanI, Guoqi ZhaoI, *
Animal Nutrition | 2024, 16(1) : 338 - 349
Less
收藏切换
Animal Nutrition | 2024, 16(1): 338-349
• Original Research Article •
Hexokinase 1 and 2 mediates glucose utilization to regulate the synthesis of kappa casein via ribosome protein subunit 6 kinase 1 in bovine mammary epithelial cells
Full
Tianyu YangI, Jia GuoI, Han SongI, Osmond DatsomorI, Yuhang ChenI, Maocheng JiangI, Kang ZhanI, Guoqi ZhaoI, *
Affiliations
  • Institute of Animal Culture Collection and Application, College of Animal Science and Technology, Yangzhou University, Yangzhou 225009, China
Published: 2024-03-10 doi: 10.1016/j.aninu.2024.01.001
Outline
收藏切换

Glucose plays a vital part in milk protein synthesis through the mTOR signaling pathway in bovine mammary epithelial cells (BMEC). The objectives of this study were to determine how glucose affects hexokinase (HK) activity in BMEC and investigate the regulatory effect of HK in kappa casein (CSN3) synthesis via the mechanistic target of rapamycin complex 1 (mTORC1) signaling pathway in BMEC. For this, HK1 and HK2 were knocked out in BMEC using the CRISPR/Cas9 system. The gene and protein expression, glucose uptake, and cell proliferation were measured. We found that glucose uptake, cell proliferation, CSN3 gene expression levels, and expression of HK1 and HK2 increased with increasing glucose concentrations. Notably, glucose uptake was significantly reduced in HK2 knockout (HK2KO) BMEC treated with 17.5 mM glucose. Moreover, under the same glucose treatment conditions, the proliferative ability and abundance of CSN3 were significantly diminished in both HK1 knockout (HK1KO) and HK2KO BMEC compared with that in wild-type BEMC. We further observed that the phosphorylation levels of ribosome protein subunit 6 kinase 1 (S6K1) were reduced in HK1KO and HK2KO BMEC following treatment with 17.5 mM glucose. As expected, the levels of glucose-6-phosphate and the mRNA expression levels of glycolysis-related genes were decreased in both HK1KO and HK2KO BMEC following glucose treatment. These results indicated that the knockout of HK1 and HK2 inhibited cell proliferation and CSN3 expression in BMEC under glucose treatment, which may be associated with the inactivation of the S6K1 and inhibition of glycolysis.

Glucose  /  Hexokinase  /  Milk protein  /  Mechanistic target of rapamycin complex 1 signaling pathway  /  Bovine mammary epithelial cell  /  Kappa casein
Tianyu Yang, Jia Guo, Han Song, Osmond Datsomor, Yuhang Chen, Maocheng Jiang, Kang Zhan, Guoqi Zhao. Hexokinase 1 and 2 mediates glucose utilization to regulate the synthesis of kappa casein via ribosome protein subunit 6 kinase 1 in bovine mammary epithelial cells[J]. Animal Nutrition, 2024 , 16 (1) : 338 -349 . DOI: 10.1016/j.aninu.2024.01.001
Full Text
Less
1.　Introduction
Less
A continuous supply of glucose is required for the maintenance of lactation. Indeed, glucose requirements in lactating dairy cows are nearly 4-fold those for non-lactating ones (Bell and Bauman, 1997). The lactating mammary gland consumes up to 85% of the circulating glucose for milk production (Bickerstaffe and Annison, 1974). Consequently, glucose deficiency leads to a reduction in milk protein synthesis. One study showed that dairy cows with high milk protein concentration had higher glucose than dairy cows with low milk protein concentration (Wang et al., 2022). In addition, shortening dry period decreased milk protein in dairy cows under heat stress, accompanied by lower serum glucose concentration (Boustan et al., 2021), suggesting that glucose plays a pivotal role in milk protein synthesis. Toerien et al. (2010) reported that jugular infusion of glucose enhanced milk protein yield in feed-deprived dairy cows, with similar results in lactating dairy goats (Safayi and Nielsen, 2013). Glucose is a potent activator of milk protein synthesis (Toerien et al., 2004). Conversely, deficiency glucose suppressed casein gene and protein expression of bovine mammary epithelial cells (BMEC) (Zhang et al., 2018). Therefore, glucose uptake plays a crucial role in the mammary gland's ability to synthesize milk protein.
Milk protein synthesis positively correlates with glucose supply (Rius et al., 2010). However, evidence suggests that, in ruminants, mammary glucose supply and glucose uptake may not always be strongly linked, and other factors may play a determinant role in regulating glucose uptake. Compared with extracellular glucose concentrations, the metabolic activity of the mammary glands was more strongly related to glucose uptake (Nielsen et al., 2001; Xiao and Cant, 2005). Hexokinases (HK) play an essential role in glucose metabolism. In the cytoplasm, HK phosphorylate the glucose taken up into cells via glucose transporters (GLUT), yielding glucose-6-phosphate (G6P), the first rate-limiting step in glucose metabolism. HK exist as four isoforms—HK1 to HK4—that differ in their catalytic and regulatory characteristics and exhibit tissue-specific expression patterns (Wilson, 2003). HK1 and HK2 are expressed in both rats' and sows' lactating mammary glands, the latter at exceptionally high levels (Kaselonis et al., 1999; Chen et al., 2017), suggesting that both enzymes are involved in milk synthesis. Protein synthesis is a highly adenosine-triphosphate (ATP)-dependent activity strongly correlated with cellular energy metabolism. Glycolysis is one of the major metabolic pathways and a key source of cellular energy. The inhibition of HK activity can result in reduced levels of G6P, which limits ATP production and protein synthesis. However, little is known regarding the role of HK in milk protein biosynthesis or the putative underlying mechanisms.
In milk-producing mammary glands, glucose is a precursor and a signaling regulator (Kimball and Jefferson, 2006; Burgos et al., 2013). However, the mechanism by which the milk-producing mammary gland detects and adjusts to glucose availability is incompletely understood. The mechanistic target of rapamycin complex1 (mTORC1) signaling pathway, which controls glucose-dependent cell proliferation, growth, and metabolism (Saxton and Sabatini, 2017), is a key pathway for elucidating this mechanism. The mTORC1 pathway activation has been documented in bovine mammary cells, as evidenced by the presence of phosphorylated (p)-mTOR (Ser2448) (Appuhamy et al., 2011). The ribosomal protein S6 kinase 1 (S6K1), a rate-limiting regulator of cell growth and casein expression (Appuhamy et al., 2011; Nan et al., 2014; Yang et al., 2015), is a direct substrate for phosphorylation by mTOR. Understanding the molecular processes underlying the relationship between HK and mTORC1 pathway activation in BMEC could lead to developing strategies for increasing the efficiency with which BMEC utilizes glucose via specific adjustments in nutrient delivery.
Glucose was reported to regulate cell proliferation and casein expression through the mTORC1 signaling pathway in BMEC (Nan et al., 2014; Yang et al., 2015). Although it has previously been demonstrated that glucose promotes protein translation by activating the mTORC1 pathway in BMEC, little is known about how HK regulate casein expression. Kappa casein (CSN3) is an important component of milk protein (Wang et al., 2016). For example, the degree of glycosylation CSN3 can affect the synthesis of casein and milk protein (Robitaille et al., 1991). CSN3 knockout mice cannot lactate and the casein micelles in the secretions are unstable (Shekar et al., 2006). We hypothesized that HK1- and HK2-mediated glucose utilization regulates CSN3 synthesis via the mTORC1 signaling pathway. Accordingly, in this study, we explored the role of HK in the mTORC1 signaling pathway associated with CSN3 synthesis in BMEC.
2.　Materials and methods
Less
2.1.　 Animal ethics statement
The experiments were approved by the Institutional Animal Care and Use Committee of Yangzhou University (SYXK (Su) IACUC 2012-0029), Yangzhou, China.
2.2.　 Cell culture
The immortalized BMEC by SV40 large T used in this study were provided by the Institute of Animal Culture Collection and Application (IACCA), Yangzhou University (Zhan et al., 2016). The BMEC were grown in DMEM/F12 (C11330500BT, Gibco, China) containing lactational hormones (5 g/mL insulin, 1 g/mL prolactin, and 1 g/mL hydrocortisone; Sigma-Aldrich, St Louis, MO, USA), 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 mg/mL streptomycin.
2.3.　 Generation of HK1 and HK2 knockout BMEC
Exon 4 of the bovine HK1 gene (GenBank ID: 280817) and exon 3 of the bovine HK2 gene (GenBank ID: 788926) were selected as the target loci for editing. The sgRNAs were constructed using CHOP-CHOP (http://chopchop.cbu.uib.no/) (Moyer and Holland, 2015). All prospective 25-bp primer sequences followed by 5′-CACCG-3′ were graded and evaluated based on predicted efficiency scores and the number of potential off-target sites (up to three mismatches in the protospacer), 40% to 60% guanine-cytosine content, and self-complementarity score (≤1) (Edick et al., 2021). The sequences of the sgRNAs (synthesized by Genewiz Bioscience Co., Ltd, Suzhou, China) are shown in Table 1. The sgRNAs were subcloned into the lentiCRISPR v2 vector (52961, Addgene, USA), yielding HK1-sgRNA1, HK1-sgRNA2, HK1-sgRNA3, HK2-sgRNA1, HK2-sgRNA2, and HK2-sgRNA3.
HEK293T cells were seeded in six-well plates and cultured to 70% to 80% confluence. The cells were then co-transfected with 2.5 μg of lentiCRISPR v2-sgRNA1–3 plasmids, 1.5 μg of pMDLg/pRRE plasmid, 0.7 μg of pRSV-Rev plasmid, and 1 μg of pMD 2.G plasmid using PEI MAX (24765-1, Polysciences, USA) following the manufacturer's instructions. After culturing at 37 °C under 5% CO2 for 8 h, the medium was replaced with a 10% FBS-supplemented growth medium, and the cells were cultured for a further 24 h, after which the medium was changed. Lentiviruses were collected between 48 and 72 h later and the media containing the viruses were collected and strained through a 0.45-µm sieve to remove cells and other debris from the supernatant. The BMEC (60% to 70% confluence) were infected with lentivirus supernatants for 72 h and were then extracted using 0.05% trypsin–0.02% ethylenediaminetetraacetic acid (EDTA) solution; half the BMEC were harvested to extract genome DNA. The remaining BMEC continued to grow in 6-well plates. Genomic DNA was extracted from a single-cell colony using a genomic DNA extraction kit (DP214-02, Tiangen, China). The genomic area encompassing the CRISPR/Cas9-gRNA target site was amplified using PCR SuperMix (Thermo Fisher Scientific). The HK1- and HK2-specific primers (5′ to 3′) were as follows: Forward: GTCTTAACACTGAACCTCCA, Reverse: CAGACCATCCAGTAAGAGAA; and Forward: TCACCTAGAGATGACCAGTC, Reverse: AAATCCCTCCCACTAAAGCA, respectively (Figs. 5A and 6A). The sequencing assay confirmed whether the target HK1 and HK2 genes were mutated. Scramble peaks at the gRNA target site indicate that the target was active. Then mutated BMEC were extracted using 0.05% trypsin–0.02% EDTA solution, and then it was diluted and aliquoted into 96-well plates, and the medium was replaced every 5 days. After 1 month, positive clones were subjected to sequencing analysis. Finally, the amplicon sequences were cloned into the T vector (6013, Takara, Beijing, China) and sequenced to prove the absence of base number.
2.4.　 Experimental design
To examine the effect of glucose in BMEC, cells were plated into six-well plates at a density of 1 × 105 cells per well. At 80% confluence, the BMEC were starved in a medium without glucose (D6540, Solarbio, China) for 2 h and subsequently incubated in a medium containing different concentrations of glucose (0, 2.5, 10, or 17.5 mM) as previously reported (Zhang et al., 2018). To determine the effect of HK in response to glucose treatment, HK1 knockout (HK1KO), HK2 knockout (HK2KO), and wild-type BMEC were plated into six-well plates at a density of 1 × 105 cells per well. At 80% confluence, the cells were starved in a medium without glucose (D6540, Solarbio, China) for 2 h and subsequently incubated in the presence (17.5 mM) or absence of glucose. All the media (D6540, Solarbio, China) used for treatments were serum-free and adjusted to pH 7.4. The cells were harvested after 24 h of incubation to assess their proliferative ability (performed in sextuplicate) and after 6 h incubation for all other experiments (performed in triplicate).
2.5.　 Analysis of glucose uptake and cell proliferation
A colorimetric glucose oxidase/peroxidase assay kit (E1010-1, Applygen, China) was used to determine the amount of glucose present in the culture medium. The amount of glucose absorbed was estimated as the difference between the amounts before and after 6-h incubation and presented as miligrams of glucose per miligram of protein per hour (Silva et al., 2022). A BCA Protein Assay Kit (P0012, Beyotime, Beijing, China) was used to assess the total protein content of the cells, and a Cell Counting Kit-8 (CCK-8) assay kit (A311, Vazyme Biotech Co., Ltd, China) was used for the estimation of cell proliferation, as previously described (Yang et al., 2022). The HK1KO, HK2KO, and wild-type BMEC were seeded into 96-well plates at 1250, 2500, 5000, 10,000, and 20,000 cells per well to generate a standard curve. After treatment, the cells were washed five times with 200 μL of sterile water and then cultured in 100 μL of DMEM supplemented with 10 μL of CCK-8 reagent at 37 °C with 5% CO2 for 3 h. The absorbance of each well at 450 nm was determined using an automated microplate reader (Multiskan GO, Thermo Scientific, Shanghai, China).
2.6.　 Determination of HK activity and G6P levels
HK activity was assessed using a total HK assay kit (BC0740, Solarbio). Briefly, the cells were lysed and cleared by centrifugation, 5 μL of the lysate was transferred into 195 μL of reaction buffer on ice, and the absorbance at 340 nm was quickly measured using an automated microplate reader (Thermo Scientific, Shanghai, China). Total HK activity was calculated as the optical density (OD) determined after 5 min minus the value measured at 0 min, which was reported as nanomole NADPH generated per milligram of protein per minute. The G6P levels were determined using a Glucose-6-phosphate Colorimetric Assay Kit (K011, Elabscience, China) according to the manufacturer's guidelines (www.elabscience.cn).
2.7.　 Quantitative RT-PCR
The cells were seeded at a density of 2 × 105 cells/well in six-well plates for mRNA expression analysis. Total RNA was extracted using a FastPure Cell/Tissue Total RNA Isolation Kit (RC101, Vazyme Biotech Co., Ltd, Nanjing, China). RNA quality was assessed using 2% agarose gel electrophoresis, while RNA purity and concentration were assessed using an OD-1000+ microspectrophotometer (One drop-1000+, Thermo Scientific, Shanghai, China). The total RNA OD260/280 ratio between 1.9 and 2.0 and the 28S ribosomal RNA band intensity in total RNA samples was approximately 2-fold that of the 18S ribosomal RNA band, indicating the total RNA was of excellent quality (Ma et al., 2021a,b). The RNA was reverse transcribed using an RT kit from Takara (RR047, Beijing, China) in a reaction mixture containing 1 μg of total RNA and 1× PrimeScript RT Master Mix in a final volume of 20 μL (37 °C for 15 min). Reverse transcriptase was inactivated at 85 °C for 5 s. Quantitative real-time PCR (qPCR) was performed using SYBR Premix Ex Taq II (RR091Q, Takara, Beijing, China). The 20-μL reaction mixture contained SYBR Premix Ex Taq II, 0.4 μM of each forward and reverse primer, and 100 ng of cDNA. qPCR comprised an initial denaturation at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. Where possible, the primers were designed to span exon–exon junctions. Primer dimer formation was assessed by melting curve analysis after amplification to validate the occurrence of a single product. Table 2 contains a list of the primers used. A no-template negative control reaction was included. RefFinder (http://www.leonxie.com/referencegene.php), which uses Normfinder, geNorm, and the comparative ΔCT approach, was used to rank the candidate genes, from which the first-rank reference genes (actin beta [ACTB], ribosomal protein S9 [RPS9], and glyceraldehyde-3-phosphate dehydrogenase [GAPDH]) were selected. The final ranking was determined by assigning a suitable weight to each gene and then calculating the geometric mean of their weights. A lower geometric mean of ranking denoted greater expression stability. Finally, ACTB was screened for subsequent study. Relative mRNA expression levels were calculated using the 2−ΔΔCt method (Livak and Schmittgen, 2001). Each trial was conducted in triplicate.
2.8.　 Western blotting analysis
Cells were seeded in a 10-cm dish (2 × 106 cells/well) for protein expression analysis and cultured at 37 °C with 5% CO2. Cells were lysed in RIPA lysis buffer (89900, Thermo Scientific, Shanghai, China) containing 1× protease inhibitor cocktail (1862209, Thermo Scientific, Shanghai, China) and 1× phosphatase inhibitor cocktail (1862209, Roche, Shanghai, China), yielding total protein. Protein concentrations were measured using a BCA kit (P0010, Beyotime, China) according to the protocols specified by the manufacturer. Equal amounts (40 μg) of protein were separated by SDS–PAGE and transferred to nitrocellulose membranes (PALL, Shanghai, China). The membranes were then blocked in blocking buffer (5% horse serum in Tris-buffered saline with Tween 20 [TBS-T: 10 mM Tris–HCl, pH 7.5, 150 mM NaCl, 0.05% Tween 20]) and incubated overnight at 4 °C with primary antibodies (diluted in blocking buffer) targeting GAPDH (2118, 1:1,000; CST, Shanghai, China), mTOR (2972, 1:750; CST, Shanghai, China), p-mTOR (2971, 1:750; CST, Shanghai, China), S6K1 (9202, 1:750; CST, Shanghai, China), p-S6K1 (9234, 1:750; CST, Shanghai, China), HK1 (AF1726, 1:750; Beyotime, China), HK2 (ab209847, 1:750; Abcam, USA), and CSN3 (orb482191, 1:750; Biorbyt). After washing, the membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibody (goat anti-rabbit IgG [7074, 1:5000; CST, Shanghai, China]). Pierce ECL Plus Western Blotting Substrate or Super Signal West Femto Maximum Sensitivity Substrate (46640, Thermo Scientific, Shanghai, China) were employed for the detection of target bands.
2.9.　 Immunofluorescence analysis
Immunofluorescence analysis was undertaken as previously described (Zhan et al., 2020). Briefly, cells cultured on chamber slides were fixed in methanol and acetone for 20 min at 20 °C, blocked for 1 h at room temperature in PBS containing 3% horse serum, and then incubated with anti-HK1 and anti-HK2 primary antibodies overnight at 4 °C. After gentle rinsing in PBS, the cells were incubated for 45 min with FITC-conjugated anti-rabbit IgG (1:400; sc-3753, Santa Cruz, Shanghai, China), rinsed in PBS, and counterstained with DAPI for 5 min. Finally, the samples were mounted in PermaFluor mounting medium (TA006FM, Thermo Scientific, Shanghai, China), coverslipped, and observed and imaged using a confocal laser scanning microscope (BX53, Olympus, Tokyo, Japan).
2.10.　 Statistical analysis
All data were analyzed using SPSS 19.0 software (SPSS Inc., Chicago, IL, USA). The data are shown as the mean and pooled standard error of the mean (SEM). The effects of glucose were calculated using one-way ANOVA with Bonferroni's multiple-range test to evaluate the difference between different treatment groups. Other studies were subjected to two-way ANOVA analysis, and the statistical model included the effects of the cell type and glucose levels and their interactions. A post hoc test was conducted using Bonferroni's multiple comparison test for significant interactions. P-values < 0.05 were considered significant.
3.　Results
Less
3.1.　 The effect of glucose on CSN3 expression and HK activity in BMEC
A profile of the mRNA expression of CSN3 in BMEC treated with various glucose concentrations is presented in Fig. 1A. The gene expression of CSN3 was 2-fold greater in BMEC treated with 17.5 mM than in untreated BMEC (P = 0.037); however, compared with the negative controls, no differences in CSN3 gene expression were observed with glucose treatments at the 2.5 and 10 mM concentrations (P > 0.05). Higher CSN3 expression was accompanied by increased glucose uptake. Compared with the 2.5 mM group, glucose uptake by BMEC was greater in both the 10 (P = 0.035) and 17.5 (P = 0.012) mM glucose treatment groups (Fig. 1B). BMEC viability was increased with increasing glucose availability, with the greatest effect seen in the 17.5 mM group relative to that in the negative control (glucose deficiency) group (P < 0.001) (Fig. 1C).
Next, the expression levels of HK1 and HK2 were examined to further investigate the mechanisms underlying how glucose addition influences CSN3 gene expression in BMEC. We found that the activities of overall HK in BMEC were diminished with decreasing glucose concentrations (Fig. 2A), whereas the opposite was observed with increasing glucose availability (2.5 mM, P = 0.015; 10 mM, P = 0.026; 17.5 mM, P = 0.002), compared with the negative control group. Similarly, the mRNA abundance of HK1 in BMEC was significantly enhanced under all glucose concentrations tested (all P < 0.05), and the gene expression of HK2 was remarkably increased under 2.5 and 17.5 mM concentration treated (P < 0.05), relative to that in the negative controls (Fig. 2B and C). Immunofluorescence results showed that the protein expression of HK1 increased in 10 (P < 0.001) and 17.5 mM (P < 0.001) glucose, and HK2 was upregulated in all glucose treatments (all P < 0.05), relative to the negative control group (Figs. 3 and 4).
3.2.　 The establishment of HK1 and HK2 knockout BMEC lines
To assess the functions of the HK1 and HK2 genes, we generated HK1KO and HK2KO BMEC lines using CRISPR/Cas9. First, three gRNAs targeting exon 4 of HK1 and three targeting exon 3 of HK2 were designed. The PCR products of the targeted HK1 and HK2 genomic regions were subjected first to a cruiser enzyme digestion assay for Cas9-sgRNA activity assessment and then to sequencing analysis. Sequence analysis showed that the HK1 clone and the 8th clone of HK2 sgRNA1 (HK2 1 to 8 clone) were associated with scrambled peaks at the gRNA target sites (Figs. 5A and 6A). In the HK1 and HK2 1 to 8 clone, one allele had a deletion flanking the gRNA3 and gRNA1 regions, respectively, whereas the other allele was unedited. To clarify the precise target site of the deletion in the HK1 clone, the relevant PCR products were cloned into the T vector and subjected to sequence analysis. The results showed that the HK1 clone had a 2-bp deletion beside the gRNA3 target site (Fig. 5B and C). In addition, the 6th clone of HK2 sgRNA2 (HK2 2 to 6 clone) had a 5-bp deletion flanking the gRNA2 target sequence (Fig. 6B and C). The expression of HK1 in HK1KO BMEC and HK2 in HK2KO BMEC was assessed by Western blotting (Figs. 5D and E and 6D, E). Our dates showed that compared with WT BMEC, HK1 KO BMEC and HK2 2 to 6 clone BMEC abolished (P < 0.001) the protein expression of HK1 and HK2, respectively. Accordingly, HK1KO and HK2KO BMEC lines originating from the HK1 and HK2 2 to 6 clone were used in subsequent experiments.
3.3.　 The effect of HK1KO and HK2KO on protein synthesis in BMEC treated with glucose
After generating the HK1KO and HK2KO model BMEC lines, we next evaluated the effect of HK deletion on the ability of BMEC to respond to glucose. We found that glucose uptake was decreased in HK2KO BMEC compared with that in wild-type cells (P < 0.001), whereas no difference in glucose uptake was observed between wild-type and HK1KO BMEC (P = 0.394) (Fig. 7A). The proliferative ability of both HK1KO (P = 0.003) and HK2KO (P < 0.001) BMEC was decreased in the presence of glucose, compared with wild-type BMEC treated with 17.5 mM glucose; in addition, the proliferation of HK2KO BMEC, but not HK1KO BMEC, was also decreased (P = 0.037) under conditions of glucose deprivation, related to wild-type BMEC (Fig. 7B). Meanwhile, compared with wild-type BMEC treated with 17.5 mM glucose, the mRNA abundance of CSN3 was decreased in both HK1KO (P < 0.01) and HK2KO (P < 0.01) BMEC treated with 17.5 mM glucose (Fig. 7C). The protein expression of CSN3 showed a similar trend (Fig. 7D and E). These results showed that HK1 and HK2 mediated the regulatory effects of glucose on cell proliferation and CSN3 gene and protein expression in BMEC.
Glycolysis is a key source of the cellular energy required for protein synthesis and growth. As expected, we found that G6P levels were higher (P = 0.050) in BMEC treated with glucose than in those subjected to glucose deprivation. However, in the presence of glucose, the G6P levels were lower in both HK1KO BMEC (P = 0.045) and HK2KO BMEC (P = 0.003) than in wild-type BMEC (Fig. 8B). Next, we evaluated the effect of HK1 and HK2 on the expression of glycolysis-related genes by qPCR (Fig. 8C and D). The results showed that the mRNA expression levels of glucose-6-phosphatase isomerase (GPI), fructose-bisphosphate A (ALDOA), and fructose-bisphosphate C (ALDOC) were unaffected (P > 0.005) in response to either glucose addition or HK knockdown. The relative mRNA expression levels of phosphofructokinase muscle (PFKM) (P = 0.046) and ALDOB (P = 0.050) were higher in BMEC supplied with glucose than in those subjected to glucose deprivation. In the case of glucose deprivation, compared with wild-type BMEC, the relative mRNA expression levels of ALDOB decreased in HK1KO BMEC (P = 0.026). With glucose supplementation, meanwhile, the relative mRNA abundance of phosphofructokinase liver type (PFKL) and ALDOB was lower in both HK1KO BMEC (P = 0.050 and P < 0.001, respectively) and HK2KO BMEC (P = 0.018, and P < 0.001, respectively) than in wild-type BMEC. In addition, HK2KO BMEC treated with glucose decreased the mRNA gene of PFKM (P = 0.001) compared to wild-type BMEC treated with glucose.
The mTORC1 signaling pathway was related to both cell proliferation and casein expression. Compared with wild-type BMEC, following glucose treatment, the p-S6K1 level was reduced (P < 0.001) in both HK1KO and HK2KO BMEC (Fig. 9A and B).
4.　Discussion
Less
Glucose supply can influence the mTOR signal transduction pathway and milk protein synthesis in immortalized mammary cells (Zhang et al., 2018). Zhao et al. (2012) also proposed that HK2 might perform a vital function in glucose uptake in BMEC. However, relatively little is known regarding the role of HK in milk protein biosynthesis in BMEC in the presence of glucose or the putative underlying mechanism.
Glucose plays a central role in metabolism in almost all organisms and can serve as a precursor for the synthesis of nucleotides. In this study, cells were starved overnight and treated with three concentrations of glucose, with the highest concentration being more than 3-fold higher than that typically seen in the blood of dairy cows. We found that increased glucose availability was accompanied by a concomitant increase in glucose uptake by BMEC, which is consistent with that reported by Rius et al. (2010). Cell growth requires a high rate of protein synthesis and a large amount of cellular energy. In the same pattern, the highest glucose concentration was sufficient for cell proliferation. Lunt and Vander Heiden (2011) argued that enhanced glucose metabolism is selected for in proliferating cells throughout nature because increased glucose uptake can supply sufficient amounts of the chemical building blocks, such as nucleotides, amino acids, and lipids, that are required for the synthesis of macromolecules necessary for cell growth. In addition, although glucose has a key role in milk protein synthesis, milk protein production is also an energy-dependent process (Lobley, 1990). Our data showed that glucose deficiency leads to lower CSN3 gene expression, consistent with previously reported (Zhang et al., 2018). These findings support that glucose can increase the CSN3 expression in BMEC.
HK are essential enzymes for glucose metabolism and have been suggested to play a vital role in milk synthesis during lactation. To test this hypothesis, we investigated the activity of these enzymes in BMEC in this study. We found that increasing glucose availability was associated with greater HK activities, which was consistent with the results of a previous study suggesting that HK activities were positively correlated with glucose uptake (Yamada et al., 2005). HK1 and HK2 are expressed in the mammary glands of lactating rats (Kaselonis et al., 1999), and it is interesting to identify the vital function exerted by each HK during milk protein synthesis. The qPCR and immunofluorescence results indicated that the expression of both HK1 and HK2 was significantly increased in BMEC following glucose treatment, suggesting that the two enzymes may perform an important function in milk protein synthesis.
To explore the mechanisms underlying the effects of HK on milk protein synthesis, we generated HK1KO and HK2KO BMEC lines. We observed that glucose uptake was unaffected in HK1KO BMEC; however, glucose uptake was markedly decreased in HK2KO BMEC, as also previously shown in BMEC exposed to 3-bromopyruvate, an inhibitor of HK2 (Zhao et al., 2012). This supports the previous assumption that HK2, rather than HK1, may perform a vital function in glucose uptake in BEMC. However, in our study, the gene expression of CSN3 was decreased in both HK1KO and HK2KO BMEC following glucose treatment. Moreover, although we found that the proliferative capacity of HK1KO/HK2KO BMEC was reduced compared with that of wild-type BMEC, these differences were only noticeable under conditions of glucose supplementation. It has been reported that the inhibition of HK1 and HK2 can induce apoptotic cell death (Pastorino and Hoek, 2003). These decreases in cell proliferation rates may have partly resulted from the activation of mitochondrial apoptotic signaling cascades. These results may indicate that glucose uptake is not the main factor affecting protein synthesis and cell proliferation in BMEC.
During glycolysis, which is a key mediator of cellular energy metabolism (Brooks, 2009), glucose is transformed into pyruvate, NADH, and ATP (Tran and Wang, 2019). Protein turnover contributes to approximately half of the ATP consumption in the mammary epithelium, owing to the high demand for protein in milk production (Hanigan et al., 2009). Accordingly, glycolysis plays a vital role in protein synthesis. Our data showed that the relative mRNA expression levels of the glycolysis-related genes PFKL, PFKM, and ALDOB were decreased in HK1KO and HK2KO BMEC in response to glucose treatment, whereas those of GPI, ALDOA, and ALDOC were unaffected. HK phosphorylate glucose to generate G6P, which is subsequently converted to fructose-6-phosphate (F6P) by the activity of GPI. We found that glucose supplementation to HK1KO and HK2KO BMEC decreased G6P levels, which may have resulted in reduced ATP production. However, GPI mRNA expression was not decreased in HK1KO and HK2KO BMEC in response to glucose treatment, which may have been due to the G6P-to-F6P conversion being a reversible reaction. Phosphofructokinases convert F6P into fructose-1,6-bisphosphate (FBP) while aldolase (ALDO), of which there are three subunits (ALDOA, ALDOB, and ALDOC), splits FBP into dihydroxyacetone phosphate (DHAP) and GAPDH. The results of the present study show that, compared with that in wild-type BMEC, the mRNA expression levels of PFKL and ALDOB were decreased in HK1KO and HK2KO BMEC; meanwhile, HK2KO also decreased the mRNA expression levels of PFKM under glucose treatment; suggesting that the knockout of HK1 and HK2 can lead to a decrease in FBP, DHAP, and GAPDH production for glycolysis. The inhibition of glycolysis can interfere with ATP production and activate the AMPK pathway, thereby inhibiting protein synthesis (Jiang et al., 2008; Inoki et al., 2003). The effects of HK1 and HK2 loss on PFKL, PFKM, and ALDOB expression in BMEC under glucose treatment may prevent glucose conversion into ATP, resulting in less available energy for milk protein synthesis.
The role of mTORC1 in milk protein synthesis has been well characterized. Studies have demonstrated that glucose infusion in feed-deprived dairy cows can increase the levels of p-mTOR and p-S6K1, thereby enhancing protein synthesis in mammary tissue (Toerien et al., 2010). Zhang et al. (2018) reported that glucose enhances protein synthesis in BMEC by promoting mTORC1 signaling. The levels of S6K1 phosphorylation in HK1KO and HK2KO BMEC were only decreased in the presence of glucose. Sharma et al. (2007) found that glucose phosphorylation is required for mTORC1 signaling activation and that G6P can induce the phosphorylation of S6K1. Our data were consistent with these observations, which suggests that the decrease in p-S6K1 levels may have been due to the downregulation of G6P expression. Accordingly, the suppression of phosphorylation of S6K1 kinase may have occurred owing to lower levels of G6P. Additionally, the effect of HK1 and HK2 deficiency on casein synthesis suggests that increasing HK1 and HK2 expression in BMEC may represent a vital strategy for stimulating mammary protein production. However, this possibility requires further investigation in dairy cows.
5.　Conclusions
Less
In this study, we found that glucose treatment increased the mRNA expression of CSN3, promoted cell proliferation, and enhanced HK activity in BMEC. The knockout of HK1 and HK2 inhibited cell proliferation and CSN3 gene and protein expression in BMEC under glucose treatment, which may have been associated with the inactivation of the S6K1 kinase and inhibition of glycolysis. These observations highlight that HK1 and HK2 exert vital functions in CSN3 protein expression by regulating S6K1 kinase.
References
Less
Appuhamy JA, Bell AL, Nayananjalie WA, Escobar J, Hanigan MD. Essential amino acids regulate both initiation and elongation of mRNA translation independent of insulin in MAC-T cells and bovine mammary tissue slices. J Nutr 2011;141(6): 1209-15.
Bell AW, Bauman DE. Adaptations of glucose metabolism during pregnancy and lactation. J Mammary Gland Biol Neoplasia 1997;2(3):265-78.
Bickerstaffe R, Annison EF. The metabolism of glucose, acetate, lipids and amino acids in lactating dairy cows. J Agric Sci 1974;82:71-85.
Boustan A, Vahedi V, Farab MA, Karami H, Seyedsharifi R, Evrigh NH, Ghazaei C, Salem AZM. Effects of dry period length on milk yield and content and metabolic status of high-producing dairy cows under heat stress. Trop Anim Health Prod 2021;53(2):205.
Brooks GA. Cell-cell and intracellular lactate shuttles. J Physiol 2009;587:5591-600.
Burgos SA, Kim JJ, Dai M, Cant JP. Energy depletion of bovine mammary epithelial cells activates AMPK and suppresses protein synthesis through inhibition of mTORC1 signaling. Horm Metab Res 2013;45(3):183-9.
Chen F, Chen B, Guan W, Chen J, Lv Y, Qiao H, Wang C, Zhang Y. Metabolic transition of milk lactose synthesis and up-regulation by AKT1 in sows from late pregnancy to lactation. Cell Biochem Biophys 2017;75(1):131-8.
Edick A, Audette MJ, Burgos SA. CRISPR-Cas9-mediated knockout of GCN2 reveals a critical role in sensing amino acid deprivation in bovine mammary epithelial cells. J Dairy Sci 2021;104(1):1123-35.
Hanigan MD, France J, Mabjeesh SJ, McNabb WC, Bequette BJ. High rates of mammary tissue protein turnover in lactating goats are energetically costly. J Nutr 2009;139:1118-27.
Inoki K, Zhu T, Guan KL. TSC2 mediates cellular energy response to control cell growth and survival. Cell 2003;115:577-90.
Jiang W, Zhu Z, Thompson HJ. Modulation of the activities of AMPactivated protein kinase, protein kinase B, and mammalian target of rapamycin by limiting energy availability with 2-deoxyglucose. Mol Carcinog 2008;47:616-28.
Kimball SR, Jefferson LS. Signaling pathways and molecular mechanisms through which branched-chain amino acids mediate translational control of protein synthesis. J Nutr 2006;136(1 Suppl):227S-31S.
Kaselonis GL, McCabe ER, Gray SM. Expression of hexokinase 1 and hexokinase 2 in mammary tissue of nonlactating and lactating rats: evaluation by RT-PCR. Mol Genet Metab 1999;68(3):371-4.
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)). Method Methods 2001;25: 402-8. https://doi.org/10.1006/meth.2001.1262.
Lobley GE. Energy metabolism reactions in ruminant muscle: responses to age, nutrition and hormonal status. Reprod Nutr Dev 1990;30(1):13-34.
Lunt SY, Vander Heiden MG. Aerobic glycolysis: meeting the metabolic requirements of cell proliferation. Annu Rev Cell Dev Biol 2011;27:441-64.
Ma Y, Wang C, Elmhadi H, Zhang H, Han Y, Shen B, He BL, Liu XY, Wang HR. Thiamine ameliorates metabolic disorders induced by a long-term highconcentrate diet and promotes rumen epithelial development in goats. J Dairy Sci 2021a;104(11):11522-36.
Ma Y, Zhang Y, Zhang H, Wang H, Elmhadi M. Thiamine alleviates high-concentratediet-induced oxidative stress, apoptosis, and protects the rumen epithelial barrier function in goats. Front Vet Sci 2021b;8:663698.
Moyer TC, Holland AJ. Generation of a conditional analog-sensitive kinase in human cells using CRISPR/Cas9-mediated genome engineering. Centrosome Centriole 2015;129:19-36.
Nan X, Bu D, Li X, Wang J, Wei H, Hu H, Zhou L, Loor JJ. Ratio of lysine to methionine alters expression of genes involved in milk protein transcription and translation and mTOR phosphorylation in bovine mammary cells. Physiol Genom 2014;46(7):268-75.
Nielsen MO, Madsen TG, Hedeboe AM. Regulation of mammary glucose uptake in goats: role of mammary gland supply, insulin, IGF-1 and synthetic capacity. J Dairy Res 2001;68(3):337-49.
Pastorino JG, Hoek JB. Hexokinase II: the integration of energy metabolism and control of apoptosis. Curr Med Chem 2003;10(16):1535-51.
Rius AG, Appuhamy JA, Cyriac J, Kirovski D, Becvar O, Escobar J, McGilliard ML, Bequette BJ, Akers RM, Hanigan MD. Regulation of protein synthesis in mammary glands of lactating dairy cows by starch and amino acids. J Dairy Sci 2010;93(7):3114-27.
Robitaille G, Ng-Kwai-Hang KF, Monardes HG. Association of kappa-casein glycosylation with milk production and composition in Holsteins. J Dairy Sci 1991;74(10):3314-7.
Safayi S, Nielsen MO. Intravenous supplementation of acetate, glucose or essential amino acids to an energy and protein deficient diet in early and late lactating dairy goats: effects on milk production and mammary nutrient extraction. Small Rumin Res 2013;112:162-73.
Saxton RA, Sabatini DM. mTOR signaling in growth, metabolism, and disease. Cell 2017;169(2):361-71.
Sharma S, Guthrie PH, Chan SS, Haq Syed, Taegtmeyer H. Glucose phosphorylation is required for insulin-dependent mTOR signalling in the heart. Cardiovasc Res 2007;76(1):71-80.
Shekar PC, Goel S, Rani SD, Sarathi DP, Alex JL, Singh S, Kumar S. Kappa-caseindeficient mice fail to lactate. Proc Natl Acad Sci U S A 2006;103(21):8000-5.
Silva J, Ganesan VVS, Wickramasinghe H, Stepanchenko N, Kaya CA, Beitz DC, Appuhamy J. Effects of branched-chain amino acids on glucose uptake and lactose synthesis rates in bovine mammary epithelial cells and lactating mammary tissue slices. J Dairy Sci 2022;105(2):1717-30.
Toerien CA, Trout DR, Cant JP. Effect of nutrients on p70S6K activation in the bovine mammary gland. J Anim Feed Sci 2004;13(Suppl. 1):449-52.
Toerien CA, Trout DR, Cant JP. Nutritional stimulation of milk protein yield of cows is associated with changes in phosphorylation of mammary eukaryotic initiation factor 2 and ribosomal s6 kinase 1. J Nutr 2010;140(2):285-92.
Tran DH, Wang ZV. Glucose metabolism in cardiac hypertrophy and heart failure. J Am Heart Assoc 2019;8:e012673.
Wang MZ, Ji Y, Wang C, Chen LM, Wang HR, Loor JJ. The preliminary study on the effects of growth hormone and insulin-like growth factor-I on kappa-casein synthesis in bovine mammary epithelial cells in vitro. J Anim Physiol Anim Nutr 2016;100(2):251-5.
Wang X, Xu J, Han Z. Plasma proteomic profiling reveals the regulatory factors of milk protein synthesis in holstein cows. Biology 2022;11(8):1239.
Wilson JE. Isozymes of mammalian hexokinase: structure, subcellular localization and metabolic function. J Exp Biol 2003;206(Pt 12):2049-57.
Xiao CT, Cant JP. Relationship between glucose transport and metabolism in isolated bovine mammary epithelial cells. J Dairy Sci 2005;88(8):2794-805.
Yang JX, Wang CH, Xu QB, Zhao FQ, Liu JX, Liu HY. Methionyl-methionine promotes alpha-s1 casein synthesis in bovine mammary gland explants by enhancing intracellular substrate availability and activating JAK2-STAT5 and mTOR-mediated signaling pathways. J Nutr 2015;145(8):1748-53.
Yang T, Datsomor O, Jiang M, Ma X, Zhao G, Zhan K. Protective roles of sodium butyrate in lipopolysaccharide-induced bovine ruminal epithelial cells by activating G protein-coupled receptors 41. Front Nutr 2022;9:842634.
Yamada K, Brink I, Bisse E, Epting T, Engelhardt R. Factors influencing (F-18) 2-fluoro-2-deoxy-D-glucose (F-18 FDG) uptake in melanoma cells: the role of proliferation rate, viability, glucose transporter expression and hexokinase activity. J Dermatol 2005;32(5):316-34.
Zhan K, Lin M, Zhao QM, Zhan JS, Zhao GQ. Biological characterization of bovine mammary epithelial cell lines immortalized by HPV16 E6/E7 and SV40T. In Vitro Cell Dev Biol Anim 2016;52(9):906-10.
Zhan K, Yang TY, Chen Y, Jiang MC, Zhao GQ. Propionate enhances the expression of key genes involved in the gluconeogenic pathway in bovine intestinal epithelial cells. J Dairy Sci 2020;103(6):5514-24.
Zhao K, Liu HY, Wang HF, Zhou MM, Liu JX. Effect of glucose availability on glucose transport in bovine mammary epithelial cells. Animal 2012;6(3):488-93.
Zhang MC, Zhao SG, Wang SS, Luo CC, Gao HN, Zheng N, Wang JQ. d-Glucose and amino acid deficiency inhibits casein synthesis through JAK2/STAT5 and AMPK/mTOR signaling pathways in mammary epithelial cells of dairy cows. J Dairy Sci 2018;101(2):1737-46.
Appendix
Less
Year 2024 volume 16 Issue 1
PDF
44
25
Cite this Article
BibTeX
Article Info
doi: 10.1016/j.aninu.2024.01.001
  • Receive Date：2022-12-16
  • Online Date：2026-01-28
  • Published：2024-03-10
Article Data
Affiliations
History
  • Received：2022-12-16
  • Revised：2023-12-09
  • Accepted：2024-01-07
Affiliations
    Institute of Animal Culture Collection and Application, College of Animal Science and Technology, Yangzhou University, Yangzhou 225009, China

Corresponding:

*

Corresponding author. E-mail address: (G. Zhao).
References
Share
https://castjournals.cast.org.cn/joweb/aninu/EN/10.1016/j.aninu.2024.01.001
Share to
QR

Scan QR to access full text

Cite this article
BibTeX
Citations
表12种不同金属材料的力学参数
科
Family		 属数
Number of
genus		 种数
Number of
species		 占总种数比例
Percentage of
total species (%)		 属
Genus		 种数
Number of
species		 占总种数比例
Percentage of total
species (%)
鹅膏菌科Amanitaceae 2 11 5.26 鹅膏菌属 Amanita 10 4.78
小菇科 Mycenaceae 2 12 5.74 丝盖伞属 Inocybe 5 2.39
多孔菌科 Polyporaceae 8 14 6.70 蜡蘑属 Laccaria 5 2.39
红菇科 Russulaceae 3 23 11.00 小皮伞属 Marasmius 6 2.87
小菇属 Mycena 11 5.26
光柄菇属 Pluteus 5 2.39
红菇属 Russula 17 8.13
栓菌属 Trametes 5 2.39
关闭全屏
  • BibTeX
  • EndNote
  • RefWorks
  • TxT
Links
Articles
Latest Articles
Most Read
Collections
Updates
Events
News
Multimedia
About
About Us
Contact
No. 86 Xueyuan South Road, Haidian District, Beijing
100081
010-62199257
qkjq@cast.org.cn

Copyright © 2025 China Association for Science and Technology. All rights reserved. For all open access content, the relevant licensing terms apply.
Sponsored by the Office of the Leading Group for Cybersecurity and Informatization of CAST, and supported by Science and Technology Review Publishing House