Growth performance, serum parameters, inflammatory responses, intestinal morphology and microbiota of weaned piglets fed 18% crude protein diets with different ratios of standardized ileal digestible isoleucine to lysine

PDF

Jian Wang^a, Sujie Liu^a, Jiayu Ma^a, Xiaoli Dong^c, Shenfei Long^a^,^*, Xiangshu Piao^a^,^b^,^*

Animal Nutrition | 2024, 16(1) : 313 - 325

Less

Animal Nutrition | 2024, 16(1): 313-325

• Original Research Article •

Full

Jian Wang^a, Sujie Liu^a, Jiayu Ma^a, Xiaoli Dong^c, Shenfei Long^a^,^*, Xiangshu Piao^a^,^b^,^*

Affiliations

^aState Key Laboratory of Animal Nutrition, College of Animal Science and Technology, China Agricultural University, Beijing 100193, China

^bBeijing Jingwa Agricultural Science and Technology Innovation Center, Beijing, 101206, China

^cCJ International Trading Co., Ltd, Shanghai 201107, China

Published: 2024-03-10 doi: 10.1016/j.aninu.2023.11.008

Outline

Abstract

Less

The present study was to explore the Ile requirement of piglets fed 18% crude protein (CP) diets. Two hundred and fifty 28-day-old Duroc × Landrace × Yorkshire piglets (8.37 ± 1.92 kg) were randomly divided into 5 dietary treatments (10 piglets per replicate, 5 barrows and 5 gilts per replicate) with 45%, 50%, 55%, 60%, 65% standardized ileal digestible (SID) Ile-to-Lys ratios, and the SID Lys was formulated to 1.19%. The experimental design consisted of two phases (d 1 to 14 and d 15 to 28). Results showed that average daily gain (ADG) had a tendency to quadratically increase as the SID Ile-to-Lys ratio increased (P = 0.09), and the optimum SID Ile-to-Lys ratios required to maximize ADG were 48.33% and 54.63% for broken-line linear model and quadratic polynomial model, respectively. Different SID Ile-to-Lys ratios had no significant effects on average daily feed intake and gain-to-feed ratio. Dry matter (P < 0.01), CP (P = 0.01), ether extract (P = 0.04), gross energy (P < 0.01) and organic matter (P < 0.01) digestibility increased quadratically. Serum total cholesterol levels decreased linearly (P = 0.01) and quadratically (P < 0.01); aspartate aminotransferase (P < 0.01), interleukin-1β (P = 0.01), and tumor necrosis factor-α (P < 0.01) levels decreased quadratically; immunoglobulin G (P = 0.03) and immunoglobulin M (P = 0.01) concentrations increased quadratically. Serum Ser levels decreased linearly (P < 0.01) and quadratically (P = 0.01); Glu (P = 0.02), Arg (P = 0.05), and Thr (P = 0.03) levels decreased quadratically; Gly (P < 0.01) and Leu (P = 0.01) levels decreased linearly; Ile (P < 0.01) concentration increased linearly. Duodenal villus height (P < 0.01) and villus height to crypt depth ratio (P < 0.01) increased quadratically. The deficiency or excess of Ile decreased short chain fatty acid-producing bacteria abundance and increased pathogenic bacteria abundance. Overall, taking ADG as the effect index, the optimum SID Ile-to-Lys ratios of piglets offered 18% CP diets were 48.33% and 54.63% based on two different statistical models, respectively, and the deficiency or excess of lle negatively affected piglet growth rates and health status.

Key words

Weaned piglet / Growth performance / Intestinal health / Isoleucine / Reduced crude protein diet

Cite this Article

Jian Wang, Sujie Liu, Jiayu Ma, Xiaoli Dong, Shenfei Long, Xiangshu Piao. Growth performance, serum parameters, inflammatory responses, intestinal morphology and microbiota of weaned piglets fed 18% crude protein diets with different ratios of standardized ileal digestible isoleucine to lysine[J]. Animal Nutrition, 2024 , 16 (1) : 313 -325 . DOI: 10.1016/j.aninu.2023.11.008

Full Text

Less

1.　Introduction

Less

Nitrogen pollution and dietary protein source shortage limit pig industrial development, so protein restriction is considered a promising strategy (Zhang and Piao, 2022). Additionally, weaning is a stressful event that negatively impacts digestion and absorption capacity, immune function and intestinal microbiota in piglets (Ma et al., 2021a). A reduction of dietary protein level can alleviate weaning stress of piglets; however, benefits of the reduction in protein levels are usually accompanied by sub-optimal growth of piglets, as organisms need to reduce protein synthesis rates to adapt to insufficient protein intake (Garlick et al., 1999). It has been reported that low protein diets containing functional amino acids (AA) can improve growth rate and nitrogen utilization of piglets (Figueroa et al., 2002; Lordelo et al., 2008; Torrazza et al., 2010). It has been well documented that except for Lys, Met, Thr and Trp, branched chain amino acids (BCAA) supplemented to low protein diets can improve piglet performance (Lordelo et al., 2008).

The BCAA including Leu, Ile and Val regulate key metabolic pathways that are necessary for maintenance, growth and immunity, and can only be offered through diets (Zhang et al., 2017; Zhou et al., 2018). The BCAA were reported to improve feed intake, AA utilization efficiency, immune function, intestinal development and microbial composition of piglets (Zhang et al., 2013a; Ren et al., 2015; Kwon et al., 2020; Habibi et al., 2021). Insufficient levels of BCAA in the diet may negatively affect growth rates of piglets (van Milgen et al., 2012). However, several studies demonstrated that excessive intake of AA reduced energy utilization efficiency (Just, 1982). When the level of AA in diets reaches the required level, the nitrogen utilization efficiency is the highest (van Milgen et al., 2012). As one of the BCAA, it is necessary to explore Ile requirements in pig diets. However, most studies focused on Ile requirements of pigs fed diets with blood products (van Milgen et al., 2012). Further research is necessary to explore requirements of Ile in piglets fed blood cell-free diets, and facilitate the preparation of diets with more reasonable AA levels. Additionally, physiological and nutritional functions of Ile still need to be clarified. We can further explore the recommended level of Ile by analyzing the impacts of Ile on serum biochemical indices and intestinal health of pigs. Therefore, this experiment aimed to estimate the optimal standardized ileal digestible (SID) level of Ile in 18% crude protein (CP) diets, and explore the effects of Ile on growth performance, serum biochemical indices and intestinal health of piglets.

2.　Materials and methods

Less

2.1.　 Animal ethics statement

The Institutional Animal Care and Use Committee of China Agricultural University approved the experimental procedures used in this study (Beijing, China). CJ Cheiljedang Corporation (Seoul, Korea) provided the Ile product in this experiment.

2.2.　 Experimental animals, design, diets, management and procedures

Two hundred and fifty 28-d-old Duroc × Landrace × Yorkshire piglets (8.37 ± 1.92 kg) were randomly divided into 5 groups according to a randomized complete block design based on body weight (BW) and gender. Each group contained 5 replicates (10 piglets per replicate), and 5 barrows and 5 gilts per replicate. The 250 piglets were fed 18% CP diets with SID Ile-to-Lys ratios of 45% (N45), 50% (N50), 55% (N55), 60% (N60) and 65% (N65). The SID AA levels were calculated by multiplying the SID coefficients provided by the NRC (2012) by AA levels of these ingredients. An experimental diet containing 1.19% SID Lys was prepared, which was lower than the value obtained from the NRC (2012). The Lys level aimed to ensure that Lys has a marginal limit on pigs and the SID Ile-to-Lys ratio requirement is not underestimated. Except Ile, the remaining indispensable AA-to-Lys ratios were set to exceed the NRC (2012) recommendation by 105% (Table 1). The experiment period consisted of phase 1 (d 1 to 14) and phase 2 (d 15 to 28). The piglets were raised in the pens with plastic floors and nipple drinkers, and had free access to water and feed throughout the period. The room temperature was controlled at 24 to 26 °C. During this experiment, the weaned piglets were vaccinated on d 7, 14 and 21, and the health status of the piglets was regularly monitored.

2.3.　 Sample collection

We collected about 1000 g feces of each pen from d 26 to 28, then the samples were mixed completely and kept in an oven drying at 65 °C for 72 h. The collected feed and fecal samples were ground to pass through a 1-mm sieve and kept at 4 °C for further analysis. On d 28, approximately 5 mL of blood was sampled from each barrow with BW closest to the mean pen BW per pen using vacuum tubes, then centrifuged at 3000 × g for 15 min for collecting the supernatant. Subsequently, one barrow per pen (with BW closest to the mean BW in each pen) was slaughtered, and the samples of pancreas, ileum, chyme of ileum, cecum and colon were collected and rapidly placed in liquid nitrogen. The samples of the middle parts of the duodenum, jejunum and ileum were also collected and fixed with 4% paraformaldehyde for hematoxylin and eosin staining.

2.4.　 Growth performance, diarrhea rate and nutrient digestibility

The BW of piglets and feed consumption of each pen were recorded to calculate the average daily gain (ADG), average daily feed intake (ADFI) and gain-to-feed ratio. During the experiment, the fecal consistency of piglets was assessed and evaluated every day to calculate the diarrhea rates as previously reported (Shang et al., 2021a).

The proximate composition ash, CP, ether extract (EE) and dry matter (DM) of the feed and fecal samples were determined according the Association of Official Agricultural Chemists (AOAC, 2012). The gross energy (GE) was determined by using the adiabatic oxygen bomb calorimeter (Parr 6300 Calorimeter, Moline, IL, USA). The chromium (Cr) concentration was analyzed using anatomic absorption spectrometry (Z-5000; Hitachi, Tokyo, Japan) as Williams et al. (1962) described. The apparent total tract digestibility (ATTD) of nutrients was calculated as follows:

For analyzing AA, excluding Met, Trp and Cys, feed samples were first treated with 6 mol/L HCl for 24 h at 110 °C, and AA composition was determined using an automatic amino acid analyzer (Hitachi High-Technologies Co., Japan, L-8900). Cys and Met were measured as cysteic acid and methionine sulfone after hot acid hydrolysis and quantitative oxidation with performic acid. The Trp level was examined by high performance liquid chromatography (Agilent 1200 Series; Aligent, Santa Clara, CA, USA) after hydrolysis in 4 mol/L LiOH for 22 h at 110 °C.

2.5.　 Serum biochemical indices and amino acids

The Sykam S433 amino acid analyzer was applied to determine serum AA concentrations as previously described (Sedgwick et al., 1991). Serum biochemical indices including urea nitrogen (BUN), glucose (GLU), triglyceride (TG), total cholesterol (TC), creatine kinase (CK), high density lipoprotein (HDL), low density lipoprotein (LDL), lactate dehydrogenase (LDH), total protein (TP), albumin (ALB), globulin (GLB), aspartate aminotransferase (AST), alanine aminotransferase (ALT), and alkaline phosphatase (ALP) were determined by commercially available kits (Laibo Tairui Technology Development Co., Ltd, Beijing, China).

2.6.　 Digestive enzyme activity

For determination of pancreatic enzyme activity, approximately 1 mg of pancreatic tissue samples was homogenized on ice with 9 mL of phosphate buffer saline. The homogenized tissues were centrifuged at 12,000 × g for 15 min at 4 °C. The supernatants were carefully collected, and the double antibody sandwich enzyme-linked immunosorbent assay (ELISA) was used to measure activities of α-amylase, lipase, chymotrypsin and trypsin, using ELISA kits (Laibo Tairui Technology Development Co., Ltd, Beijing, China). The total concentrations of protein in samples were measured using a bicinchoninic acid protein assay kit (Jiancheng Bioengineering Institute, Nanjing, China).

2.7.　 Intestinal morphology

For analyzing intestinal morphology, samples were embedded in paraffin after dehydration with ethanol solution, then sliced into sections of 4 μm by a microtome (Leica, Wetzlar, Germany) and stained by hematoxylin and eosin to determine villus height (VH), crypt depth (CD), and VH to CD ratio. The examination of sections was performed at least in 10 well-oriented intact villi and their associated crypts by light microscopy.

2.8.　 Immunoglobulin and cytokine levels

Serum immunoglobulin A (IgA), immunoglobulin M (IgM), immunoglobulin G (IgG), interleukin-1β (IL-1β), interleukin-6 (IL-6), interleukin-10 (IL-10) and tumor necrosis factor-α (TNF-α) levels were measured by ELISA kits (Laibo Tairui Technology Development Co., Ltd, Beijing, China).

2.9.　 Tight junctional protein level

The real-time PCR analysis was performed to analyze occludin, claudin-1 and zonula occludens-1 (ZO-1) relative mRNA expression levels of ileal samples. Trizol reagent (Invitrogen, USA) was used for the extraction of total RNA, and quality and quantity of extracted RNA were assessed by a NanoDrop spectrophotometer. The PrimeScript RT Reagent kit (TaKaRa, Dalian, China) was applied to perform reverse transcription. The PCR procedure consisted of predenaturation at 95 °C for 5 min, 40 cycles of denaturation at 95 °C for 10 s, and annealing at 60 °C for 30 s. The PCR reaction mixture (10 μL) contained cDNA (1 μL), SYBR Green Master Mix (1 μL), ROX Reference Dye (0.2 μL), and forward and reverse primers (0.2 μL × 2) which are shown in Table 2. The relative expression levels of each gene were calculated by using the 2^–ΔΔCt formula (Livak and Schmittgen, 2001).

2.10.　 16S RNA sequencing

Total DNA was extracted from all ileal, cecal and colonic digesta samples using the Stool DNA Kit (Omega Bio-tek, Norcross, GA, USA). The method for DNA sequencing was carried out as previously reported (Shang et al., 2019). QIIME (version 1.17) was applied for demultiplexing and quality-filtering of raw sequences. The sequences were clustered into operational taxonomic units (OTUs) at a similarity level of 97%.

2.11.　 Short chain fatty acid (SCFA) concentration

The ileal, cecal and colonic SCFA contents were analyzed according to the method previously reported (Shang et al., 2019). Intestinal digesta was added to 8 mL of distilled water, and the mixture was then centrifuged (12,000 × g, 10 min). The collected supernatant was filtered through a 0.22-μm membrane, and then detected by an Ion Chromatography system (DIONEX ICS-3000, Thermo Fisher, Waltham, MA, USA).

2.12.　 Statistical analysis

The results in this experiment were analyzed using SAS 9.4 software (SAS Inst. Inc., Cary, NC, USA). For growth performance and diarrhea rates, the individual pen was considered as an experimental unit, and when analyzing other data, the individual pig was considered as an experimental unit. The homogeneity of variance and normal distribution were analyzed by the process of HOVTEST and PROC UNIVARIATE NORMAL, and we performed the χ² contingency test to analyze diarrhea rates. The linear and quadratic regression analyses were applied to evaluate the dose-response effect of SID Ile-to-Lys ratio. The differences were considered as significant at P < 0.05, the highly significant difference was regarded as P < 0.01, and 0.05 ≤ P < 0.10 indicted a significance of trend. The estimates of the Ile requirement for optimum performance were determined by subjecting the ADG data to the broken-line linear model, y = L + U × (R – x), where (R – x) is zero when x > R, and quadratic polynomial model, y = U (x – R)² + L, according to the formula reported by Clark et al. (2017). In these equations, y is the response of the piglet, x is the SID Ile-to-Lys ratio of the dietary treatment, U is the slope of the curve, L is the inflection point, R is the requirement of Ile. For the analysis of 16S rRNA gene sequencing data, the Chao and Shannon diversity indices were analyzed using R software (version 3.6.3), and differences were analyzed using the one-way ANOVA method. The linear discriminant analysis effect size (LEfSe) was applied to analyze differences in microbiota composition, and the biomarker was identified with linear discriminant analysis (LDA), with scores higher than 2.

3.　Results

Less

3.1.　 Growth performance and diarrhea rate

As illustrated in Table 3, from d 1 to 14, ADG showed a quadratic increase as the SID Ile-to-Lys ratio increased (P = 0.02). From d 1 to 28, ADG tended to increase quadratically as the SID Ile-to-Lys ratio increased (P = 0.09), and when piglets were fed the diet with 55% SID Ile-to-Lys ratio, the ADG was the highest. However, during all stages, ADFI, gain-to-feed ratio and diarrhea rates (Fig. 1) were not significantly affected by the dietary treatments. Because different ratios of SID Ile to Lys only significantly affected the ADG, broken-line linear and quadratic polynomial model analyses were chosen to determine the optimal SID Ile-to-Lys ratio. As shown in Fig. 2, the ADG reached the highest, when the SID Ile-to-Lys ratios were 48.33% and 54.63% based on a broken-line linear model and a quadratic polynomial model, respectively.

3.2.　 Nutrient digestibility

The ATTD of DM (P < 0.01), CP (P = 0.01), EE (P = 0.04), GE (P < 0.01) and OM (P < 0.01) quadratically enhanced as the SID Ile-to-Lys ratio increased (Table 4).

3.3.　 Serum AA and BUN levels

In Table 5, as the ratio of SID Ile-to-Lys increased, serum BUN (P < 0.01; P < 0.01), Ser (P < 0.01; P = 0.01) levels decreased linearly and quadratically. Additionally, serum Gly (P < 0.01) and Leu (P = 0.01) contents decreased linearly, Gln (P = 0.02), Arg (P = 0.05) and Thr (P = 0.03) concentrations reduced quadratically as the SID Ile-to-Lys ratio increased. Serum Ile (P < 0.01) concentration enhanced linearly with increasing SID Ile-to-Lys ratio. Additionally, different SID Ile-to-Lys ratios did not significantly affect other serum AA levels.

3.4.　 Serum biochemical indices

As the SID Ile-to-Lys ratio increased, serum TC (P = 0.01; P < 0.01) level decreased linearly and quadratically, and serum AST (P < 0.01) level decreased quadratically (Table 6).

3.5.　 Digestive enzyme activity

The trypsin (P = 0.01) and amylase (P = 0.04) activities increased quadratically with the increase of SID Ile-to-Lys ratio (Table 7). Additionally, different ratios of SID Ile to Lys did not significantly affect lipase and chymotrypsin activities.

3.6.　 Intestinal morphology

In Table 8 and Fig. 3, intestinal morphology of weaned piglets are presented. As SID Ile-to-Lys ratio increased, duodenal VH (P < 0.01) and ratio of VH to CD (P < 0.01) increased in a quadratic way.

3.7.　 Immunoglobulin and cytokine levels

As shown in Table 9, IL-1β (P = 0.01) and TNF-α (P < 0.01) contents decreased in a quadratic manner with an increase of SID Ile-to-Lys ratio. Additionally, IgG (P = 0.03) and IgM (P = 0.01) concentrations increased quadratically.

3.8.　 Tight junctional protein level

As for tight junctional protein levels (Fig. 4), among the five treatments, piglets from the N55 group had the highest mRNA expression level of occludin (P < 0.05).

3.9.　 Intestinal microbiota

The cecal microbiota composition of piglets are shown in Fig. 5. The Venn (Fig. 5A) result showed that 401 OTUs were shared, and 23, 27, 11, 16 and 38 OTUs were unique in the N45, N50, N55, N60 and N65 groups. As for alpha diversity, no differences in the Chao and Shannon indices were observed among the five treatments (Fig. 5B and C). Phyla Firmicutes and Bacteroidetes were the most abundant among the five treatments (Fig. 5D). Lactobacillaceae, Lachnospiraceae, Prevotellaceae, Ruminococcaceae, Oscillospiraceae and Clostridiaceae were dominant families (Fig. 5E). At the genus level, the top 50 microbial communities of cecal digesta are shown in Fig. 5F. To further investigate effects of various Ile-to-Lys ratios on the cecal microbiota composition of piglets, the biomarkers among different groups were identified by the LefSe analysis (Fig. 5G). Among the five treatments, the N45 group had a higher abundance of phyla Deinococcota, order Burkholderiales, family Nitrosomonadaceae and genera Nitrosomonas; whereas the N50 group had higher order Clostridia_vadinBB60_group abundance; the N55 group had more abundant genera Catenisphaera, norank_f__Prevotellaceae, norank_f__Ruminococcaceae and norank_f__Bacteroidales; and pigs from the N65 group had a higher abundance of genera Romboutsia, Terrisporobacter and Family_XIII_UCG_001 (P < 0.05). Between N45 and N55 (Fig. 5H), a higher abundance of phyla Proteobacteria, Chloroflexi, order Flavobacteriales, Kapabacteriales, Ardenticatenales, Thermomicrobiales, family Eubacterium_coprostanoligenes_group, Burkholderiaceae, Nitrosomonadaceae, Sphingomonadaceae, Saprospiraceae and genera Desulfovibrio was observed in the N45 group, and N55 had a higher abundance of order Oscillospirales, class Negativicutes, family Coriobacteriaceae and genera norank_f__Ruminococcaceae, Fournierella (P < 0.05).

The colonic microbiota of piglets from various groups is shown in Fig. 6. As shown in, 455 OTUs were shared, and 31, 19, 20, 12 and 18 OTUs were unique in the N45, N50, N55, N60 and N65 groups, respectively. The Chao and Shannon indexes were also not significantly different among all the treatments (Fig. 6B and C). The microbiota composition was mostly composed of phyla Firmicutes and Bacteroidetes (Fig. 6D). At the family level, Lactobacillaceae, Prevotellaceae, Lachnospiraceae, Ruminococcaceae, Oscillospiraceae, Muribaculaceae and Clostridiaceae were the dominant families (Fig. 6E). The microbial-community heatmap of the top 50 genera is shown in Fig. 6F. Among all the groups (Fig. 6G), the LefSe analysis showed that phyla Patescibacteria and family Saccharimonadaceae were more abundant in pigs fed the N50 diet, and pigs in N60 showed a higher abundance of genera Allisonella, and piglets in N65 presented an increased abundance of genera Candidatus_Soleaferrea (P < 0.05). Between N45 and N55 (Fig. 6H), the abundance of phyla Spirochaetota, order Clostridia_vadinBB60_group and Monoglobales, family Anaerovoracaceae, genera Butyrivibrio, Eisenbergiella, Lachnospiraceae_XPB1014_group, Eubacterium_nodatum_group, Lachnospiraceae_UCG-010, Negativibacillus, Candidatus_Soleaferrea, norank_f__Erysipelotrichaceae, Prevotellaceae_UCG-004, Clostridium_sensu_stricto_1 increased in N45, while the abundance of phyla Bacteroidota, genera Subdoligranulum, Fournierella, and Prevotella was enhanced in the N55 group (P < 0.05).

3.10.　 SCFA concentration

Cecal and colonic SCFA contents of piglets from the five treatments are shown in Table 10. As the SID Ile-to-Lys ratio increased, cecal acetate (P = 0.01; P = 0.02) concentration increased linearly and quadratically, and colonic acetate (P < 0.01) and butyrate (P = 0.01) levels increased in a quadratic way.

4.　Discussion

Less

Ile is traditionally regarded as an essential AA for pigs, because it cannot be synthesized in the body (van Milgen et al., 2012). The growth performance and health status of pigs have been demonstrated to be positively affected by appropriate intake of Ile (van Milgen et al., 2012; Wu et al., 2013). In accordance with the ideal protein concept, the requirement of Ile is defined as the ratio of Ile to Lys, Lys is generally considered the first limiting AA, while Lys should be the second limiting AA when evaluating Ile requirements (Soumeh et al., 2014; van Milgen et al., 2012). The diet containing 1.19% SID Lys was prepared in this study to ensure that Lys was marginally limiting, and the Ile requirement would not be underestimated. It has been demonstrated that the diets that included 11.4 g SID Lys/kg were formulated to evaluate the Ile requirement in 8 to 15 kg pigs, the SID Lys level of the experimental diet was 93% of values obtained from the Lys requirement (Soumeh et al., 2014).

Most studies focused on the Ile requirement of pigs fed diets with blood products due to low level of Ile in blood products, studies concerning Ile requirement of pigs fed diets without blood products are still limited (van Milgen et al., 2012). Recently, some researchers have performed experiments to explore the Ile requirement of piglets fed blood cell-free diets. In pigs fed 15.34% CP diet, optimal SID Ile-to-Lys ratios were 0.52, 0.52, 0.52 using a quadratic regression model based on ADFI, ADG and gain-to-feed ratio, respectively, and using the quadratic broken-line model, when the SID Ile-to-Lys ratios were 0.50, 0.53, 0.54, the ADFI, ADG and gain-to-feed ratio reached the greatest, respectively (Norgaard et al., 2013). The meta-analysis showed that the SID Ile-to-Lys ratio was at least 50% when pigs were fed blood cell-free diets (van Milgen et al., 2012). However, Soumeh et al. (2014) found that to maximize ADG and ADFI, the SID Ile-to-Lys ratios should be 0.52 and 0.48, respectively, in order to minimize feed conversion ratio for piglets fed diets containing 16.28% CP. Barea et al. (2009) demonstrated the SID Ile-to-Lys ratio for piglets fed diets without blood products was not greater than 50%. In this experiment, the estimated SID Ile-to-Lys ratio to obtain the highest ADG was 54.63% with a quadratic polynomial model, and when using a broken-line linear model, the SID Ile-to-Lys ratio was 48.33% for the greatest ADG. Different optimum SID Ile-to-Lys ratios based on different statistical models were observed, because a reduction was observed after maximum ADG, the quadratic polynomial model might be better than the broken-line linear model for analyzing these data. Our results are similar to the studies concerning the SID Ile-to-Lys ratio requirement (between 0.48 and 0.54) for piglets fed diets without blood products. The ratio of SID Ile to Lys did not linearly or quadratically affect ADFI, but numerically the 45% and 65% SID Ile-to-Lys ratio led to the lowest ADFI, suggesting that insufficient or excessive supply of Ile could also result in negative impacts on piglet ADFI. The gain-to-feed ratio of piglets among all treatment groups were not significantly different. Soumeh et al. (2014) also reported that the gain-to-feed ratio of piglets was not significantly affected by the ratio of Ile to Lys. The insufficient supply of BCAA in diets has been reported to negatively impact pig growth rate and health status (van Milgen et al., 2012). In this study, when the SID Ile-to-Lys ratio was 45%, which was lower than the optimal SID Ile-to-Lys ratio of 55%, 9.19% reduction in ADG was observed. In previous reports, when pig diets had a 10% decrease in the Ile content, a 21% decrease in ADG and 15% decrease in ADFI were observed (van Milgen et al., 2012). Moreover, excessive BCAA intake might lead to enhanced metabolism of BCAA, and thus negatively affect pig performance (Soumeh et al., 2014). The pigs fed a diet containing excessive Ile were reported to showed significantly reduced ADFI and ADG compared with pigs fed a diet with non-excessive levels of Ile (Norgaard et al., 2013). It was speculated that negative effects of excessive Ile might be related to AA interactions. Wiltafsky et al. (2009) also found that a too high ratio of SID Ile to Lys could lead to a reduction in performance, and speculated that the production of α-keto-β-methylvalerate by an excessive amount of Ile might activate branched-chain keto acid dehydrogenase complex (BCKDH), where BCKDH could catalyze all irreversible steps of BCAA catabolism, and thus limit the metabolism of Leu.

In this study, Ile deficiency resulted in a decrease of nutrient digestibility, and the reduction might partly explain reduced growth performance in the N45 group. We observed that Ile deficiency negatively affected intestinal morphology and decreased pancreatic digestive enzyme activity in piglets. The improvement in digestive enzyme activity and intestinal morphology may be an indicator for increasing nutrient digestibility; whereas decreased digestive enzyme activity and impaired intestinal morphology are not conducive to nutrient absorption, leading to a reduction in nutrient digestibility (Yuan et al., 2021; Zhu et al., 2021). In addition, CP digestibility was lower than most reported CP digestibility values in pigs. The reduced CP digestibility was speculated to be related to the occurrence of the weaning stress, which could result in changes in the development and function of the small intestine, disrupting digestion and absorption capacity, and finally leading to decreased nutrient digestibility (Tang et al., 2022). The low CP digestibility might also be associated with the dietary CP level, as Jie et al. (2020) reported that weaned piglets fed 17% CP diets showed lower CP digestibility compared to piglets fed 19% CP diets. Additionally, peanut meal was used in this experiment, whereas it has been reported that the application of peanut meal is limited due to anti-nutritional factors and imbalance in amino acid profile (Li et al., 2014, 2023). Until now, knowledge on effect of Ile on nutrient digestibility of piglets is limited; however, BCAA have been demonstrated to have a crucial role in nutrients digesting and absorbing in the intestine (Zhang et al., 2013b).

Dietary AA intake might affect serum AA concentration, and serum AA levels are regarded as an indicator for the measurement of AA status in the body (Sedgwick et al., 1991). In this study, alterations in serum Ser, Gly, Leu, Glu, Arg, Thr and Ile levels were observed. Soumeh et al. (2014) found that as the SID Ile-to-Lys ratio increased, Ile content increased linearly, and Leu, Gly and Ser concentrations decreased linearly. Wiltafsky et al. (2009) reported that serum Ser and Gly concentrations decreased as the ratio of SID Ile to Lys increased. Therefore, dietary Ile intake is crucial to physiological functions of pigs, and the importance of balancing BCAA in maintaining growth and health status of pigs should be emphasized (Duan et al., 2016). BUN is a serum byproduct of protein catabolism and a crucial indicator of AA utilization efficiency (Lv et al., 2018; Wang et al., 2011). In the current study, increasing dietary SID Ile-to-Lys ratio resulted in a linear and quadratic decrease in BUN level. The increase in BUN concentration is associated with a decrease in protein synthesis and enhancement of protein catabolism, and its level is negatively related to AA and protein utilization efficiency (Heo et al., 2008). A lack of enough Ile leads to decreased protein synthesis, which may promote deamination of other AA, followed by an increase in BUN level (Kwon et al., 2019). Previous research showed that BUN level decreased as Ile content increased, and high efficiency of AA utilization was observed when the intake of Ile reached the requirement (Parr et al., 2003). However, compared with N55, the BUN concentration increased in the piglets from the N65 group, indicating that excessive intake of Ile also negatively affected protein utilization efficiency.

Serum biochemical parameters can reflect the metabolic function in the body (Prvulovic et al., 2007). GLU is the basic energy and carbon source of most eukaryotic cells, as it can be oxidized to provide energy, and has a broad impact on cell function (Gaster et al., 2000). The AA could participate in the regulation of GLU level (Doi et al., 2003). Among all AA, BCAA (especially Ile) have been proven to improve GLU consumption and utilization (Doi et al., 2003). In normal rats, Ile could inhibit the increase of blood GLU concentration (Doi et al., 2003). Studies also have shown that Ile intake alone could increase the intake of GLU in pigs (Zhang et al., 2016). However, consistent with the research of Zhang et al. (2016), Ile did not significantly affect blood GLU level in this study. The blood sampling time may have affected these results; continuously measuring blood GLU level of pigs with vascular catheter might be a more appropriate sampling method. Additionally, insufficient or excessive BCAA might negatively affect lipid metabolism (Zhang et al., 2017). Serum TG and TC contents are related to lipid absorption, and HDLC and LDLC levels are associated with lipid decomposition and transport (Wang et al., 2011). The enhancement in TC levels in the N45 and N65 groups, indicating that insufficient intake or excessive intake of Ile may affect lipid metabolism of pigs. Oxidative metabolism by Ile could reduce lipid accumulation in cells (Solon-Biet et al., 2019). Additionally, excessive BCAA intake may lead to an increase in the catabolism of all BCAA, and studies have shown that excessive Leu or Ile might have an antagonistic effect, and negatively affect the function of adipose tissue and lipid metabolism (Morales et al., 2016; Zhang et al., 2021).

Higher intestinal VH indicates a larger epithelial surface area, and is crucial to nutrient absorption by the intestine, while villous atrophy can increase CD. Therefore, the ratio of VH to CD can reflect health of the intestine (Wang et al., 2020). In the current study, duodenal VH and the ratio of VH to CD of piglets increased quadratically as the ratio of Ile to Lys increased. Previous studies found that BCAA could improve intestinal morphology (Chang et al., 2015). During the process of ammonia transfer, BCAA could provide AA for the synthesis of other AA, particularly glutamic acid and aspartic acid, which are regarded as main fuels for protein turnover and nutrient transport in the small intestinal mucosal cells (Chang et al., 2015; Zhou et al., 2018). In addition, Ile has been demonstrated to upregulate expression levels of the monosaccharide transporters and promote monosaccharide absorption in the intestine of pigs, thereby potentially promoting intestinal maturation (Zhang et al., 2016).

The integrity of intestinal barrier can be evaluated by analyzing expression levels of tight junction proteins including claudin-1, occludin and ZO-1 (Mao et al., 2011; Mao et al., 2011). The intact intestinal mucosal barrier can prevent harmful bacteria and toxins from entering the body (Chen et al., 2018; Li et al., 2019). In this study, occludin mRNA expression levels were remarkably affected by the appropriate dietary SID Ile-to-Lys ratio. It also has been reported that BCAA can increase tight junction protein transcript abundance, and thus inhibit the colonization of pathogenic bacteria (Ma and Ma, 2019). The improved performance of piglets might be related to the improvement of barrier function, because intestinal mucosal barriers are the first line of defense against pathogens. Additionally, serum AST activities are considered indicator of tissue damage (Nyblom et al., 2004; Obaleye et al., 2007). The higher level of serum AST in piglets from the N45 and N65 groups indicated that the intestine of pigs fed diets containing insufficient or excessive Ile showed high membrane permeability (Ramsay et al., 2018). In this study, IL-1β and TNF-α contents were affected by different ratios of SID Ile to Lys, these inflammatory factors have been previously reported to be related to intestinal mucosal barrier damage, as the occurrence of inflammatory responses may damage intestinal barrier function. It has been reported that insufficient BCAA could negatively affect immune responses and increase sensitivity to harmful agents (Zhang et al., 2017). Ren et al. (2019) found that Ile may inhibit the increase of serum endotoxin and IL-6 levels to alleviate infection induced by E. coli. Immunoglobulins IgG, IgA and IgM are crucial to immune status, and key parts of humoral immunity (Ma et al., 2021a). Serum IgG and IgM contents increased as the ratio of Ile to Lys increased, and the increase in immunoglobulin secretion in turn can strengthen mucosal barrier function. It was reported that adding BCAA to diets could increase IgA and sIgA contents in piglets, thereby improving immune system function (Ren et al., 2015).

Intestinal microbiota is crucial to growth performance and health status of piglets (Xiong et al., 2019). The alpha diversity, such as Chao and Shannon indices, could be an indicator for evaluating intestinal microbiota (Zhang et al., 2020). No differences in alpha diversity among the 5 treatments were presented. In fact, dietary free AA were considered to be absorbed in the upper intestinal tract, and most studies showed that BCAA affected the microbial composition in the small intestine (Dai et al., 2010; Luise et al., 2023). However, Liao (2021) reported that supplementing AA may affect the overall absorption rate of AA by the host and the availability of AA by intestinal microbiota, and previous reports showed that BCAA could affect the microbiota in the hindgut of pigs (Hu et al., 2019; Luise et al., 2023). We also observed that different ratios of Ile to Lys could affect the abundance of specific bacteria. Deficient or excess intake of Ile inhibits the colonization of beneficial bacteria such as Oscillospirales, Bacteroidota and Prevotella. BCAA supplementation has been reported to promote the colonization of Prevotellaceae_UCG-004 of pigs, and BCAA significantly increased the abundance of Prevotella in the colon of mice (Yang et al., 2016; Luise et al., 2023). Previous studies reported a positive correlation between Prevotella abundance and blood BCAA circulation, and Prevotella ruminicola, a species of Prevotella, plays an important role in protein digestion and AA absorption (Broderick, 1996; Yue et al., 2019). Thus, the alterations in the abundance of Prevotella might be associated with the balance of AA intake. Although alterations in the abundance of BCAA-utilizing bacteria were observed, the source of BCAA for bacterial utilization is still not clear, and changes in the microbiota in the large intestine of piglets by Ile supplementation might be an indirect effect. Prevotellaceae shows high fiber utilizing capacity, and it is considered a SCFA-producing bacterium (Bernad-Roche et al., 2021). Oscillospirales and Bacteroidota were also demonstrated to be able to produce SCFA (Ahrens et al., 2021; Yu et al., 2017). Additionally, we also observed that as the SID Ile-to-Lys ratio increased, cecal acetate concentration increased linearly and quadratically, and colonic acetate and butyrate levels increased in a quadratic way. These changes in SCFA concentrations might be related to alterations in SCFA-producing bacteria abundance. Thus, Ile supplementation could modulate SCFA concentration in the large intestine of piglets. SCFA are regarded as an important energy source of intestine cells, contributing to the maturation of the immune system and the balance of anti/pro-inflammatory cells. They play an important role in intestinal barrier function, and inhibit the colonization of harmful bacteria (Ahrens et al., 2021; Bernad-Roche et al., 2021; Ma et al., 2021b; Morrison and Preston, 2016). In the current study, Ile deficiency or excess also increased the abundance of harmful bacteria such as Proteobacteria, Burkholderiales, Desulfovibrio, Monoglobaceae, Negativibacillus, Candidatus_Soleaferrea, Clostridium_sensu_stricto_1, Terrisporobacter and norank_f_Erysipelotrichaceae. Burkholderiales are an order of Proteobacteria, and like all Proteobacteria, they include some pathogenic bacteria (Wang et al., 2018). Increased Negativibacillus abundance is related to the occurrence of gut dysbiosis (Wang et al., 2021). Candidatus_Soleaferrea is associated with inflammatory diseases (Cao et al., 2021). Pathogenic bacteria Clostridium_sensu_stricto_1 was demonstrated to be related to inflammation in the intestine (Shang et al., 2021b). Terrisporobacter, as an emerging anaerobic pathogen, could be harmful to the gut (Chen et al., 2021). norank_f_Erysipelotrichaceae was reported to be significantly positively correlated with TNF-α and IL-1β levels (Li et al., 2022). Thus, higher abundance of beneficial bacteria and lower abundance of harmful bacteria in the N55 group might explain the improvement in immune function and growth performance of piglets. At present, the knowledge about effects of BCAA on intestinal microbiota is limited, and the effects of Ile on the microbiota in the large intestine of piglets still need to be further explored.

5.　Conclusion

Less

The optimum SID Ile-to-Lys ratio required to maximize ADG was 48.33% based on the broken-line linear model and 54.63% based on the quadratic polynomial model. Ile supplementation could improve serum biochemical parameters, immune response, intestinal morphology and microbiota, and in turn increase growth performance and nutrient digestibility. Deficiency or excess Ile in diets might result in poor performance and health status of piglets.

References

Less

Ahrens

, Culpepper

, Saldivar

, Anton

, Stoll

, Handberg

, et al. A Six-Day, Lifestyle-based immersion program mitigates cardiovascular risk factors and induces shifts in gut microbiota, specifically Lachnospiraceae, Ruminococcaceae, Faecalibacterium prausnitzii: a pilot study. Nutrients 2021;13:3459. https://doi.org/10.3390/nu13103459.

AOAC. Official methods of analysis. 19th ed. Gaithersburg, MD: AOAC International; 2012.

Barea

, Brossard

, Le Floc'h

, Primot

, van Milgen

. The standardized ileal digestible isoleucine-to-lysine requirement ratio may be less than fifty percent in eleven- to twenty-three-kilogram piglets. J Anim Sci 2009;87:4022-31. https://doi.org/10.2527/jas.2009-1964.

Bernad-Roche

, Belles

, Grasa

, Casanova-Higes

, Mainar-Jaime

. Effects of dietary supplementation with protected sodium butyrate on gut microbiota in growing-finishing pigs. Animals 2021;11:2173. https://doi.org/10.3390/ani11072137.

Broderick

. Altering ruminal nitrogen metabolism to improve protein utilization. Introduction. J Nutr 1996;126:1324S-5S. https://doi.org/10.1093/jn/126.suppl_4.1324S.

Cao

, He

, Lei

. Novel microbiota-related gene set enrichment analysis identified osteoporosis associated gut microbiota from autoimmune diseases. J Bone Miner Metabol 2021;39:984-96. https://doi.org/10.1007/s00774-021-01247-w.

Chang

, Cai

, Liu

, Chang

, Zheng

, Zhang

, et al. Effects of dietary leucine supplementation on the gene expression of mammalian target of rapamycin signaling pathway and intestinal development of broilers. Anim Nutr 2015;1: 313-9. https://doi.org/10.1016/j.aninu.2015.11.005.

Chen

, Yu

, Chen

, Huang

, Mao

, Zheng

, et al. Chlorogenic acid improves intestinal barrier functions by suppressing mucosa inflammation and improving antioxidant capacity in weaned pigs. J Nutr Biochem 2018;59:84-92. https://doi.org/10.1016/j.jnutbio.2018.06.005.

Chen

, Xie

, Zhong

, Liu

, Lin

, Xiao

, et al. Effects of xylooligosaccharides on growth and gut microbiota as potential replacements for antibiotic in weaning piglets. Front Microbiol 2021;12:641172. https://doi.org/10.3389/fmicb.2021.641172.

Clark

, Tokach

, DeRouchey

, Dritz

, Goodband

, Woodworth

, et al. Modeling the effects of standardized ileal digestible isoleucine to lysine ratio on growth performance of nursery pigs. Transl Anim Sci 2017;1:437-47. https://doi.org/10.2527/tas2017.0048.

Dai

, Zhang

, Wu

, Zhu

. Utilization of amino acids by bacteria from the pig small intestine. Amino Acids 2010;39:1201-15. https://doi.org/10.1007/s00726-010-0556-9.

Doi

, Yamaoka

, Fukunaga

, Nakayama

. Isoleucine, a potent plasma glucose-lowering amino acid, stimulates glucose uptake in C2C12 myotubes. Biochem Biophys Res Commun 2003;312:1111-7. https://doi.org/10.1016/j.bbrc.2003.11.039.

Duan

, Zeng

, Li

, Tan

, Ji

, et al. Effects of dietary branched-chain amino acid ratio on growth performance and serum amino acid pool of growing pigs. J Anim Sci 2016;94:129-34. https://doi.org/10.2527/jas.2015-9527.

Figueroa

, Lewis

, Miller

, Fischer

, Gomez

, Diedrichsen

. Nitrogen metabolism and growth performance of gilts fed standard corn-soybean meal diets or low-crude protein, amino acid-supplemented diets. J Anim Sci 2002;80: 2911-9. https://doi.org/10.2527/2002.80112911x.

Garlick

, McNurlan

, Patlak

. Adaptation of protein metabolism in relation to limits to high dietary protein intake. Eur J Clin Nutr 1999;53:S34-43. https://doi.org/10.1038/sj.ejcn.1600742.

Gaster

, Franch

, Staehr

, Beck-Nielsen

, Smith

, Schroder

. Induction of GLUT-1 protein in adult human skeletal muscle fibers. Am J Physiol Endocrinol Metab 2000;279:E1191-5. https://doi.org/10.1152/ajpendo.2000.279.5.E1191.

Habibi

, Shili

, Sutton

, Goodarzi

, Maylem

, Spicer

, et al. Branched-chain amino acids partially recover the reduced growth of pigs fed with proteinrestricted diets through both central and peripheral factors. Anim Nutr 2021;7:868-82. https://doi.org/10.1016/j.aninu.2021.02.002.

Heo

, Kim

, Hansen

, Mullan

, Hampson

, Pluske

. Effects of feeding low protein diets to piglets on plasma urea nitrogen, faecal ammonia nitrogen, the incidence of diarrhoea and performance after weaning. Arch Anim Nutr 2008;62:343-58. https://doi.org/10.1080/17450390802327811.

, Li

, Duan

, Yin

, Kong

. Dietary supplementation with leucine or in combination with arginine decreases body fat weight and alters gut microbiota composition in finishing pigs. Front Microbiol 2019;10:1767. https://doi.org/10.3389/fmicb.2019.01767.

Jie

, Gy

, Bing

, Yang

, Jh

, Ping

, et al. Dietary protease improves growth performance and nutrient digestibility in weaned piglets fed diets with different levels of soybean meal. Livest Sci 2020;241:104179. https://doi.org/10.1016/j.livsci.2020.104179.

Just

. The net energy value of crude (catabolized) protein for growth in pigs. Livest Prod Sci 1982;9:349-60. https://doi.org/10.1016/0301-6226(82)90041-0.

Kwon

, Touchette

, Simongiovanni

, Syriopoulos

, Wessels

, Stein

. Excess dietary leucine in diets for growing pigs reduces growth performance, biological value of protein, protein retention, and serotonin synthesis. J Anim Sci 2019;97:4282-92. https://doi.org/10.1093/jas/skz259.

Kwon

, Soto

, Stein

. Effects on nitrogen balance and metabolism of branched-chain amino acids by growing pigs of supplementing isoleucine and valine to diets with adequate or excess concentrations of dietary leucine. J Anim Sci 2020;98:skaa346. https://doi.org/10.1093/jas/skaa346.

, Ma

, Wen

, Xie

, Yan

, Ji

, et al. Crude polysaccharide extracted from moringa oleifera leaves prevents obesity in association with modulating gut microbiota in high-fat diet-fed mice. Front Nutr 2022;9:861588. https://doi.org/10.3389/fnut.2022.861588.

, Piao

, Liu

, Zeng

, Zhang

, Lei

. Determination and prediction of the energy content and amino acid digestibility of peanut meals fed to growing pigs. Arch Anim Nutr 2014;68:196-210. https://doi.org/10.1080/1745039X.2014.910970.

, Hou

, Jiang

, Song

, Fan

, Hou

, et al. Different dietary protein sources in low protein diets regulate colonic microbiota and barrier function in a piglet model. Food Funct 2019;10:6417-28. https://doi.org/10.1039/c9fo01154d.

, Li

, Chen

, Wang

, Liu

, Deng

, et al. Effects of solid-state fermentation on the standardized ileal digestibility of amino acids and apparent metabolizable energy in peanut meal fed to broiler chickens. Fermentation 2023;9:346. https://doi.org/10.3390/fermentation9040346.

Liao

. Invited review: maintain or improve piglet gut health around weanling: the fundamental effects of dietary amino acids. Animals 2021;11:1110. https://doi.org/10.3390/ani11041110.

Livak

, Schmittgen

. Analysis of relative gene expression data using real-time quantitative PCR and the 2^∆∆CT method. Methods: A Companion to Methods in Enzymology 2001;25:402-8.

Lordelo

, Gaspar

, Le Bellego

, Freire

. Isoleucine and valine supplementation of a low-protein corn-wheat-soybean meal-based diet for piglets: growth performance and nitrogen balance. J Anim Sci 2008;86:2936-41. https://doi.org/10.2527/jas.2007-0222.

Luise

, Correa

, Stefanelli

, Simongiovanni

, Chalvon-Demersay

, Zini

, et al. Productive and physiological implications of top-dress addition of branchedchain amino acids and arginine on lactating sows and offspring. J Anim Sci Biotechnol 2023;14:22. https://doi.org/10.1186/s40104-022-00819-8.

, Xiong

, Yang

, Wang

, He

, Liu

, et al. Effect of dietary soy oil, glucose, and glutamine on growth performance, amino acid profile, blood profile, immunity, and antioxidant capacity in weaned piglets. Sci China Life Sci 2018;61:1233-42. https://doi.org/10.1007/s11427-018-9301-y.

, Piao

, Shang

, Long

, Liu

, Mahfuz

. Mixed organic acids as an alternative to antibiotics improve serum biochemical parameters and intestinal health of weaned piglets. Anim Nutr 2021a;7:737-49. https://doi.org/10.1016/j.aninu.2020.11.018.

, Piao

, Mahfuz

, Long

, Wang

. The interaction among gut microbes, the intestinal barrier and short chain fatty acids. Anim Nutr 2021b;9:159-74. https://doi.org/10.1016/j.aninu.2021.09.012.

, Ma

. Dietary Amino acids and the gut-microbiome-immune axis: physiological Metabolism and therapeutic prospects. Compr Rev Food Sci Food Saf 2019;18:221-42. https://doi.org/10.1111/1541-4337.12401.

Mao

, Zeng

, Qiao

, Wu

, Li

. Specific roles of threonine in intestinal mucosal integrity and barrier function. Front Biosci 2011;3:1192-200. https://doi.org/10.2741/e322.

Morales

, Arce

, Cota

, Buenabad

, Avelar

, Htoo

, et al. Effect of dietary excess of branched-chain amino acids on performance and serum concentrations of amino acids in growing pigs. J Anim Physiol Anim Nutr 2016;100: 39-45. https://doi.org/10.1111/jpn.12327.

Morrison

, Preston

. Formation of short chain fatty acids by the gut microbiota and their impact on human metabolism. Gut Microb 2016;7:189-200. https://doi.org/10.1080/19490976.2015.1134082.

NRC (National Research Council). Nutrient requirements of swine. 11th ed. Washington, DC: National Academy Press; 2012.

Norgaard

, Shrestha

, Krogh

, Sloth

, Blaabjerg

, Poulsen

, et al. Isoleucine requirement of pigs weighing 8 to 18 kg fed blood cell-free diets. J Anim Sci 2013;91:3759-65. https://doi.org/10.2527/jas.2012-5998.

Nyblom

, Berggren

, Balldin

, Olsson

. High AST/ALT ratio may indicate advanced alcoholic liver disease rather than heavy drinking. Alcohol Alcohol 2004;39:336-9. https://doi.org/10.1093/alcalc/agh074.

Obaleye

, Akinremi

, Balogun

, Adebayo

. Toxicological studies and antimicrobial properties of some Iron (III) complexes of Ciprofloxacin. Afr J Biotechnol 2007;6:2826-32. https://doi.org/10.5897/AJB2007.000-2451.

Parr

, Kerr

, Baker

. Isoleucine requirement of growing (25 to 45 kg) pigs. J Anim Sci 2003;81:745-52. https://doi.org/10.2527/2003.813745x.

Prvulovic

, Jovanovi-Galovic

, Stanitic

, Popovic

, Grubor-Lajsic

. Effects of a clinoptilolite supplement in pig diets on performance and serum parameters. Czech J Anim Sci 2007;52:159-64. https://doi.org/10.17221/2317-CJAS.

Ramsay

, Stoll

, Blomberg

, Caperna

. Regulation of fetuin A gene expression in the neonatal pig liver. Animal 2018;12:288-94. https://doi.org/10.1017/S1751731117001410.

Ren

, Zhang

, Zeng

, Liu

, Qiao

. Branched-chain amino acids are beneficial to maintain growth performance and intestinal immune-related function in weaned piglets fed protein restricted diet. Asian-Australas J Anim Sci 2015;28:1742-50. https://doi.org/10.5713/ajas.14.0131.

Ren

, Cai

, Zhou

, Zhang

, Li

, Jin

, et al. Isoleucine attenuates infection induced by E. coli challenge through the modulation of intestinal endogenous antimicrobial peptide expression and the inhibition of the increase in plasma endotoxin and IL-6 in weaned pigs. Food Funct 2019;10:3535-42. https://doi.org/10.1039/C9FO00218A.

Sedgwick

, Fenton

, Thompson

. Effect of protein precipitating agents on the recovery of plasma-free amino acids. Can J Anim Sci 1991;71:953-7. https://doi.org/10.4141/cjas91-116.

Shang

, Liu

, He

, Piao

. Effects of dietary fiber sources during late gestation and lactation on sow performance, milk quality, and intestinal health in piglets. J Anim Sci 2019;97:4922-33. https://doi.org/10.1093/jas/skz278.

Shang

, Liu

, Wu

, Mahfuz

, Piao

. Source of fiber influences growth, immune responses, gut barrier function and microbiota in weaned piglets fed antibiotic-free diets. Anim Nutr 2021a;7:315-25. https://doi.org/10.1016/j.aninu.2020.12.008.

Shang

, Liu

, Mahfuz

, Piao

. Impact of sugar beet pulp and wheat bran on serum biochemical profile, inflammatory responses and gut microbiota in sows during late gestation and lactation. J Anim Sci Biotechnol 2021b;12:54. https://doi.org/10.1186/s40104-021-00573-3.

Solon-Biet

, Cogger

, Pulpitel

, Wahl

, Clark

, Bagley

, et al. Branched chain amino acids impact health and lifespan indirectly via amino acid balance and appetite control. Nat Metab 2019;1:532-45. https://doi.org/10.1038/s42255-019-0059-2.

Soumeh

, van Milgen

, Sloth

, Corrent

, Poulsen

, Norgaard

. The optimum ratio of standardized ileal digestible isoleucine to lysine for 8-15 kg pigs. Anim Feed Sci Technol 2014;198:158-65. https://doi.org/10.1016/j.anifeedsci.2014.09.013.

Tang

, Xiong

, Fang

, Li

. Weaning stress and intestinal health of piglets: a review. Front Immunol 2022;13:1042778. https://doi.org/10.3389/fimmu.2022.1042778.

Torrazza

, Suryawan

, Gazzaneo

, Orellana

, Frank

, Nguyen

, et al. Leucine supplementation of a low-protein meal increases skeletal muscle and visceral tissue protein synthesis in neonatal pigs by stimulating mTOR-dependent translation initiation. J Nutr 2010;140:2145-52. https://doi.org/10.3945/jn.110.128421.

van Milgen

, Gloaguen

, Le Floc'H

, Brossard

, Primot

, Corrent

. Meta-analysis of the response of growing pigs to the isoleucine concentration in the diet. Animal 2012;6:1601-8. https://doi.org/10.1017/S1751731112000420.

Wang

, Wu

, Feng

. Effect of dietary antibacterial peptide and zinc-methionine on performance and serum biochemical parameters in piglets. Czech J Anim Sci 2011;56:30-6. https://doi.org/10.17221/341/2009-CJAS.

Wang

, Yang

, Wang

, Li

, Huang

, Li

, et al. The relationship between villous height and growth performance, small intestinal mucosal enzymes activities and nutrient transporters expression in weaned piglets. J Anim Physiol Anim Nutr 2020;104:606-15. https://doi.org/10.1111/jpn.13299.

Wang

, Zhou

, Chen

, Jing

, Zheng

, Li

, et al. Discovery of recombinases enables genome mining of cryptic biosynthetic gene clusters in Burkholderiales species. Proc Natl Acad Sci USA 2018;115:E4255-63. https://doi.org/10.1073/pnas.1720941115.

Wang

, Gao

, Zhang

, Xiao

, Hu

, Li

, et al. Microbial and metabolic features associated with outcome of infliximab therapy in pediatric Crohn's disease. Gut Microb 2021;13:1-18. https://doi.org/10.1080/19490976.2020.1865708.

Williams

, David

, Lismaa

. The determination of chromic oxide in feces samples by atomic absorption spectrophotometry. J Agric Sci 1962;59:381-5. https://doi.org/10.1017/S002185960001546X.

Wiltafsky

, Schmidtlein

, Roth

. Estimates of the optimum dietary ratio of standardized ileal digestible valine to lysine for 8- to 25-kilogram pigs. J Anim Sci 2009;87:2544-53. https://doi.org/10.2527/jas.2008-1221.

, Wu

, Dai

, Yang

, Wang

, Liu

, et al. Dietary requirements of “nutritionally non-essential amino acids” by animals and humans. Amino Acids 2013;44:1107-13. https://doi.org/10.1007/s00726-012-1444-2.

Xiong

, Ma

, Zhang

, Jin

, Wang

, Xu

, et al. Icariin enhances intestinal barrier function by inhibiting NF-kappaB signaling pathways and modulating gut microbiota in a piglet model. RSC Adv 2019;9:37947-56. https://doi.org/10.1039/c9ra07176h.

Yang

, Huang

, Zou

, Dong

, He

, Liu

, et al. Metabolic shifts and structural changes in the gut microbiota upon branched-chain amino acid supplementation in middle-aged mice. Amino Acids 2016;48:2731-45. https://doi.org/10.1007/s00726-016-2308-y.

, Wang

, Chen

, Hu

, Wang

, Wu

, et al. Low-molecular-weight chitosan supplementation increases the population of Prevotella in the cecal contents of weanling pigs. Front Microbiol 2017;8:2782. https://doi.org/10.3389/fmicb.2017.02182.

Yuan

, Ding

, Jiang

, Ye

, Xu

, Qian

. Effects of dietary phytosterols supplementation on serum parameters, nutrient digestibility and digestive enzyme of white feather broilers. Ital J Anim Sci 2021;20:8. https://doi.org/10.1080/1828051X.2021.2000895.

Yue

, Liu

, Wang

, Meng

, Yang

, Peng

, et al. Berberine alleviates insulin resistance by reducing peripheral branched-chain amino acids. Am J Physiol Endocrinol Metab 2019;316:E73-85. https://doi.org/10.1152/ajpendo.00256.2018.

Zhang

, Liu

, Li

, Piao

. Effects of maternal 25-hydroxycholecalciferol during the last week of gestation and lactation on serum parameters, intestinal morphology and microbiota in suckling piglets. Arch Anim Nutr 2020;74: 445-61. https://doi.org/10.1080/1745039X.2020.1822710.

Zhang

, Li

, Guo

, Duan

, Yin

. Different proportions of branched-chain amino acids modulate lipid metabolism in a finishing pig model. J Agric Food Chem 2021;69:7037-48. https://doi.org/10.1021/acs.jafc.1c02001.

Zhang

, Piao

. Different dietary protein sources influence growth performance, antioxidant capacity, immunity, fecal microbiota and metabolites in weaned piglets. Anim Nutr 2022;8:71-81. https://doi.org/10.1016/j.aninu.2021.06.013.

Zhang

, Xie

, Thacker

, Htoo

, Qiao

. Estimation of the ideal ratio of standardized ileal digestible threonine to lysine for growing pigs (22-50 kg) fed low crude protein diets supplemented with crystalline amino acids. Anim Feed Sci Technol 2013a;180:83-91. https://doi.org/10.1016/j.anifeedsci.2013.01.006.

Zhang

, Qiao

, Ren

, Zeng

, Ma

, Wu

, et al. Supplementation with branched-chain amino acids to a low-protein diet regulates intestinal expression of amino acid and peptide transporters in weanling pigs. Amino Acids 2013b;45:1191-205. https://doi.org/10.1007/s00726-013-1577-y.

Zhang

, Yang

, Ren

, Qiao

, He

, Li

, et al. Effects of isoleucine on glucose uptake through the enhancement of muscular membrane concentrations of GLUT1 and GLUT4 and intestinal membrane concentrations of Na+/glucose cotransporter 1 (SGLT-1) and GLUT2. Br J Nutr 2016;116:593-602. https://doi.org/10.1017/S0007114516002439.

Zhang

, Zeng

, Ren

, Mao

, Qiao

. Novel metabolic and physiological functions of branched chain amino acids: a review. J Anim Sci Biotechnol 2017;8:10. https://doi.org/10.1186/s40104-016-0139-z.

Zhou

, Yu

, Gao

, Htoo

, Chen

. Regulation of intestinal health by branchedchain amino acids. Anim Sci J 2018;89:3-11. https://doi.org/10.1111/asj.12937.

Zhu

, Yuan

, Luo

, Shao

, Chen

. High percentage of dietary soybean meal inhibited growth, impaired intestine healthy and induced inflammation by TLR-MAPK/NF-κB signaling pathway in large yellow croaker (Larimichthys crocea). Aquac Rep 2021;20:8. https://doi.org/10.1016/j.aqrep.2021.100735.

Appendix

Less

Year 2024 volume 16 Issue 1

PDF

Cite this Article

BibTeX

Article Info

doi: 10.1016/j.aninu.2023.11.008

Receive Date：2022-12-07
Online Date：2026-01-28
Published：2024-03-10

Article Data

Affiliations

History

Received：2022-12-07
Revised：2023-11-24
Accepted：2023-11-30

Affiliations

^aState Key Laboratory of Animal Nutrition, College of Animal Science and Technology, China Agricultural University, Beijing 100193, China

^bBeijing Jingwa Agricultural Science and Technology Innovation Center, Beijing, 101206, China

^cCJ International Trading Co., Ltd, Shanghai 201107, China

Corresponding:

Corresponding authors. E-mail addresses: longshenfei@cau.edu.cn (S. Long)

piaoxsh@cau.edu.cn (X. Piao).

References

Share

https://castjournals.cast.org.cn/joweb/aninu/EN/10.1016/j.aninu.2023.11.008

Share to

Scan QR to access full text

Cite this article

BibTeX

Citations

表12种不同金属材料的力学参数

科 Family	属数 Number of genus	种数 Number of species	占总种数比例 Percentage of total species (%)	属 Genus	种数 Number of species	占总种数比例 Percentage of total species (%)
鹅膏菌科Amanitaceae	2	11	5.26	鹅膏菌属 Amanita	10	4.78
小菇科 Mycenaceae	2	12	5.74	丝盖伞属 Inocybe	5	2.39
多孔菌科 Polyporaceae	8	14	6.70	蜡蘑属 Laccaria	5	2.39
红菇科 Russulaceae	3	23	11.00	小皮伞属 Marasmius	6	2.87
				小菇属 Mycena	11	5.26
				光柄菇属 Pluteus	5	2.39
				红菇属 Russula	17	8.13
				栓菌属 Trametes	5	2.39

关闭全屏

BibTeX
EndNote
RefWorks
TxT

Table 1 Composition and nutrient levels of basal diets (%, as-fed basis).

Item	SID Ile-to-Lys ratio
Item	45%	50%	55%	60%	65%
Corn	64.12	64.06	64.00	63.94	63.88
Soybean meal, 46% CP	9.80	9.80	9.80	9.80	9.80
Fish meal, 64.7% CP	2.50	2.50	2.50	2.50	2.50
Peanut meal	3.00	3.00	3.00	3.00	3.00
Corn gluten meal	5.00	5.00	5.00	5.00	5.00
Whey powder	10.00	10.00	10.00	10.00	10.00
Soy oil	1.00	1.00	1.00	1.00	1.00
Limestone	0.80	0.80	0.80	0.80	0.80
CaHPO₃	0.85	0.85	0.85	0.85	0.85
Salt	0.33	0.33	0.33	0.33	0.33
L-Lysine HCl	0.72	0.72	0.72	0.72	0.72
DL-Met	0.30	0.30	0.30	0.30	0.30
L-Thr	0.33	0.33	0.33	0.33	0.33
L-Tyr	0.12	0.12	0.12	0.12	0.12
Val	0.18	0.18	0.18	0.18	0.18
Ile	0.00	0.06	0.12	0.18	0.24
ZnO	0.20	0.20	0.20	0.20	0.20
Cr₂O₃	0.25	0.25	0.25	0.25	0.25
Vitamin-mineral premix¹	0.50	0.50	0.50	0.50	0.50
Chemical composition
CP²	17.78	17.74	17.80	17.82	17.85
DM²	88.66	89.35	88.73	88.60	88.66
EE²	3.10	3.10	3.05	3.07	3.00
GE², MJ/kg	16.26	16.45	16.24	16.18	16.25
OM²	83.55	84.41	83.47	83.52	83.83
SID Lys³	1.19	1.19	1.19	1.19	1.19
SID Met³	0.59	0.59	0.59	0.59	0.59
SID Thr³	0.82	0.82	0.82	0.82	0.82
SID Trp³	0.24	0.24	0.24	0.24	0.24
SID Ile³	0.54	0.60	0.66	0.72	0.77
SID Leu³	1.49	1.49	1.49	1.49	1.49
SID Val³	0.84	0.84	0.84	0.84	0.84
SID Ile-to-Lys ratio³	0.45	0.50	0.55	0.60	0.65
SID Lys-to-Leu ratio³	1.25	1.25	1.25	1.25	1.25

SID = standardized ileal digestible; CP = crude protein; DM = dry matter; EE = ether extract; GE = gross energy; OM = organic matter. ¹ Premix provided the following per kilogram of diets for weaned piglets: vitamin A, 12,000 IU; vitamin D₃, 2,500 IU; vitamin E, 30 IU; vitamin K₃, 3.0 mg; vitamin B₁₂, 0.012 mg; riboflavin, 4.0 mg; pantothenic acid, 15.0 mg; niacin, 30.0 mg; choline chloride, 400.0 mg; folacin, 0.7 mg; vitamin B₁, 1.5 mg; vitamin B₆, 3 mg; Mn, 40.0 mg; Fe, 75.0 mg; Zn, 75.0 mg; Cu, 100.0 mg; I, 0.3 mg; Se, 0.3 mg. ² Analyzed values. ³ Values were calculated according to NRC (2012).

Table 2 Primer sequences of housekeeping and target genes concerned with intestinal barrier function.

Item	Primer sequences (5′ to 3′)
β-Actin	F ：TACGCCAACACGGTGCTGTC
β-Actin	R : GTACTCCTGCTTGCTGATCCACAT
Occludin	F : ATGCTTTCTCAGCCAGCGTA
Occludin	R : AAGGTTCCATAGCCTCGGTC
Claudins	F : CAAAACCTTCGCCTTCCAG
Claudins	R : TCCCCACATTCGAGATGATTAC
ZO-1	F : GAGGATGGTCACACCGTGGT
ZO-1	R : GGAGGATGCTGTTGTCTCGG

ZO-1 = zonula occludens-1; F = forward primer; R = reverse primer.

Table 3 Effects of SID Ile-to-Lys ratios on weaned piglet growth performance¹.

Item	SID Ile-to-Lys ratio					SEM	P-value
Item	45%	50%	55%	60%	65%	SEM	Linear	Quadratic
Day 1 to 14
ADG², g	384	418	424	411	392	8.7	0.83	0.02
ADFI³, g	538	563	593	565	542	11.6	0.91	0.13
Gain-to-feed ratio⁴	0.71	0.72	0.72	0.73	0.73	0.009	0.49	0.92
Day 14 to 28
ADG, g	574	612	621	602	591	11.4	0.77	0.19
ADFI, g	908	962	975	945	903	26.2	0.87	0.22
Gain-to-feed ratio	0.63	0.66	0.64	0.64	0.66	0.018	0.64	0.94
Day 1 to 28
ADG, g	479	516	523	507	493	9.6	0.76	0.09
ADFI, g	724	761	784	755	723	13.9	0.94	0.14
Gain-to-feed ratio	0.66	0.68	0.67	0.67	0.68	0.009	0.31	0.84

SID = standardized ileal digestible; SEM = standard error of the mean. ¹ n = 5. ² Average daily gain (ADG) = (body weight gain of the pen/piglets' number)/days. ³ Average daily feed intake (ADFI) = (feed intake of the pen/piglets' number)/days. ⁴ Gain-to-feed ratio = body weight gain of the pen/feed intake of the pen.

Table 4 Effects of SID Ile-to-Lys ratios on nutrient digestibility of weaned piglets (%)¹.

Item	SID Ile-to-Lys ratio					SEM	P-value
Item	45%	50%	55%	60%	65%	SEM	Linear	Quadratic
DM	76.44	81.97	82.91	80.72	78.88	0.883	0.17	<0.01
CP	53.39	63.89	65.67	63.47	58.16	3.052	0.33	0.01
EE	47.37	57.86	55.13	58.23	50.39	2.905	0.58	0.04
GE	74.03	78.27	80.37	81.25	76.49	1.564	0.11	<0.01
OM	79.53	84.23	85.08	83.41	81.30	0.848	0.28	<0.01

SID = standardized ileal digestible; SEM = standard error of the mean; DM = dry matter; CP = crude protein; EE = ether extract; GE = gross energy; OM = organic matter. ¹ n = 5.

Table 5 Effects of SID Ile-to-Lys ratios on serum urea nitrogen and amino acid concentrations of weaned piglets (μmol/L) ¹.

Item	SID Ile-to-Lys ratio					SEM	P-value
Item	45%	50%	55%	60%	65%	SEM	Linear	Quadratic
BUN, mmol/L	4.23	2.14	2.00	2.28	2.84	0.247	<0.01	<0.01
Asn	73.63	69.10	47.15	72.43	73.70	10.233	0.92	0.15
Gln	699.50	547.80	459.30	630.00	807.00	90.038	0.20	0.02
His	33.73	20.23	27.43	26.25	26.45	5.183	0.61	0.34
Ser	292.00	192.75	164.00	160.00	177.25	22.750	<0.01	0.01
Asp	101.55	106.98	98.23	88.73	142.20	17.677	0.55	0.44
Glu	273.00	303.75	286.50	270.25	417.50	41.986	0.05	0.13
Gly	1982.5	1417.5	1265.5	1057.0	1125.0	66.54	<0.01	0.06
Arg	340.75	234.25	238.00	298.75	331.75	40.654	0.73	0.05
Cys	12.98	8.94	5.74	4.90	11.48	6.409	0.70	0.27
Pro	292.00	276.50	228.75	273.75	291.00	25.591	0.96	0.13
Tyr	72.15	70.40	60.08	57.10	58.48	6.604	0.20	0.71
Lys	533.00	505.50	366.80	485.30	528.50	91.439	0.93	0.29
Met	159.25	130.93	101.48	91.78	146.18	25.908	0.47	0.09
Val	363.50	320.75	263.00	287.25	316.50	69.613	0.57	0.40
Phe	89.55	72.60	83.45	83.68	82.55	7.546	0.92	0.56
Trp	52.48	35.18	39.40	42.48	42.00	8.093	0.66	0.38
Thr	361.00	323.50	283.25	240.00	344.00	32.162	0.25	0.03
Ala	677.50	593.25	492.25	603.25	621.75	63.890	0.64	0.11
Ile	33.78	62.90	76.85	111.58	134.88	18.960	<0.01	0.90
Leu	237.00	198.25	182.25	170.50	169.00	16.067	0.01	0.24

SID = standardized ileal digestible; SEM = standard error of the mean; BUN = urea nitrogen. ¹ n = 5.

Table 6 Effects of SID Ile-to-Lys ratios on serum biochemical parameters of weaned piglets¹.

Item	SID Ile-to-Lys ratio					SEM	P-value
Item	45%	50%	55%	60%	65%	SEM	Linear	Quadratic
GLU, mmol/L	5.67	5.79	6.19	5.79	6.39	0.214	0.94	0.11
TG, mmol/L	0.52	0.48	0.39	0.48	0.38	0.042	0.05	0.74
TC, mmol/L	2.22	1.72	1.54	1.48	1.78	0.116	0.01	<0.01
CK, U/L	990.20	1050.00	712.20	627.00	1335.00	41.366	0.79	0.20
HDL, mmol/L	0.48	0.70	0.49	0.60	0.68	0.059	0.14	0.84
LDL, mmol/L	1.19	1.54	1.46	1.25	1.31	0.110	0.91	0.10
LDH, U/L	636.43	465.29	457.44	563.61	390.25	69.017	0.06	0.65
TP, g/L	51.28	52.13	63.08	51.98	50.81	4.314	0.94	0.13
ALB, g/L	25.42	21.74	22.87	23.98	23.17	1.702	0.65	0.34
GLB, g/L	40.91	26.33	26.30	25.63	26.80	5.339	0.10	0.13
AST, U/L	75.47	33.39	50.04	48.21	71.57	6.016	0.79	<0.01
ALT, U/L	56.04	44.38	41.86	47.55	40.04	5.071	0.06	0.35
ALP, U/L	362.79	333.57	276.24	269.55	316.42	28.679	0.11	0.08

SID = standardized ileal digestible; SEM = standard error of the mean; GLU = glucose; TG = triglyceride; TC = total cholesterol; CK = creatine kinase; HDL = high density lipoprotein; LDL = low density lipoprotein; LDH = lactate dehydrogenase; TP = total protein; ALB = albumin; GLB = globulin; AST = aspartate aminotransferase; ALT = alanine aminotransferase; ALP = alkaline phosphatase. ¹ n = 5.

Table 7 Effects of SID Ile-to-Lys ratios on pancreatic digestive enzyme activities of weaned piglets (U/g) ¹.

Item	SID Ile-to-Lys ratio					SEM	P-value
Item	45%	50%	55%	60%	65%	SEM	Linear	Quadratic
Trypsin	3.82	5.45	8.27	5.86	3.96	0.881	0.88	0.01
Lipase	24.44	34.08	35.23	43.08	24.38	6.852	0.71	0.10
Amylase	15.49	23.74	23.83	22.75	15.82	3.212	0.98	0.04
Chymotrypsin	9.59	13.59	13.21	18.14	9.69	2.070	0.55	0.06

SID = standardized ileal digestible; SEM = standard error of the mean. ¹ n = 5.

Table 8 Effects of SID Ile-to-Lys ratios on intestinal morphology of weaned piglets¹.

Item	SID Ile-to-Lys ratio					SEM	P-value
Item	45%	50%	55%	60%	65%	SEM	Linear	Quadratic
Duodenum
VH, μm	220.00	346.20	447.61	324.30	270.49	30.821	0.40	<0.01
CD, μm	363.16	366.10	341.07	338.06	379.26	27.845	0.96	0.34
VH-to-CD ratio	0.61	0.96	1.36	0.97	0.72	0.140	0.59	<0.01
Jejunum
VH, μm	354.15	366.82	305.47	317.38	327.01	35.537	0.34	0.59
CD, μm	300.37	307.01	366.00	310.83	298.15	25.466	1.00	0.19
VH-to-CD ratio	1.19	1.26	0.84	1.02	1.12	0.163	0.43	0.27
Ileum
VH, μm	212.98	185.44	189.71	219.32	206.16	26.541	0.82	0.61
CD, μm	191.27	240.83	224.38	194.30	207.73	30.034	0.88	0.43
VH-to-CD ratio	1.12	0.77	0.87	1.12	1.09	0.143	0.57	0.22

SID = standardized ileal digestible; SEM = standard error of the mean; VH = villus height; CD = crypt depth. ¹ n = 5.

Table 9 Effects of SID Ile-to-Lys ratios on inflammatory factors of weaned piglets¹.

Item	SID Ile-to-Lys ratio					SEM	P-value
Item	45%	50%	55%	60%	65%	SEM	Linear	Quadratic
IgA, μg/mL	14.11	14.02	15.06	13.51	13.64	0.411	0.24	0.14
IgG, mg/mL	6.51	6.93	7.25	6.64	6.66	0.194	0.99	0.03
IgM, μg/mL	6.08	6.38	6.33	6.09	5.84	0.144	0.08	0.01
IL-1β, ng/L	108.45	96.23	99.69	106.21	107.44	3.105	0.39	0.01
IL-6, ng/L	33.20	34.29	34.04	33.77	34.90	0.509	0.06	0.98
IL-10, ng/L	19.02	18.60	17.68	19.44	19.69	0.737	0.39	0.18
TNF-α, ng/L	54.93	52.11	49.44	53.15	54.68	1.008	0.90	<0.01

SID = standardized ileal digestible; SEM = standard error of the mean; Ig = immunoglobulin; IL = interleukin; TNF = tumor necrosis factor. ¹ n = 5.

Table 10 Effects of SID Ile-to-Lys ratios on short chain fatty acid concentrations of weaned piglets (mg/kg) ¹.

Item	SID Ile-to-Lys ratio					SEM	P-value
Item	45%	50%	55%	60%	65%	SEM	Linear	Quadratic
Cecum
Acetate	4742.2	6185.3	5679.6	5776.6	5877.5	110.44	0.01	0.02
Propionate	1987.8	2165.0	2504.6	2267.8	2735.9	68.56	0.02	1.00
Butyrate	1114.1	1241.9	1515.3	1324.1	1532.6	52.77	0.09	0.61
Isovalerate	234.24	260.59	236.81	242.11	381.82	37.331	0.06	0.13
Colon
Acetate	4527.3	5507.5	6433.4	5462.3	5133.8	95.42	0.22	<0.01
Propionate	1825.7	2114.6	2051.9	2394.3	2750.0	24.65	0.01	0.51
Butyrate	1149.5	1461.5	2120.7	1459.4	1337.0	72.84	0.52	0.01
Isovalerate	311.56	328.18	430.04	444.75	403.62	45.568	0.10	0.33

SID = standardized ileal digestible; SEM = standard error of the mean. ¹ n = 5.

Fig. 1. Effects of standardized ileal digestible (SID) Ile-to-Lys ratios on the diarrhea rates of weaned piglets. The results are presented as the mean and SEM. (A) Day 1 to 14, (B) day 14 to 28, and (C) day 1 to 28 of the experiment. The CP content of five treatments was consistent at 17.8%, and SID Ile-to-Lys ratios were 45% (N45), 50% (N50), 55% (N55), 60% (N60) and 65% (N65). CP = crude protein; SEM = standard error of the mean.

Fig. 2. The optimum standardized ileal digestible (SID) Ile-to-Lys ratio determined by subjecting the average daily gain (ADG) data to the broken-line and quadratic polynomial models. The quadratic model is as follows: if x ≤ requirement, y = −0.40 (x – 54.63)² + 511.98, where estimated SID Ile-to-Lys ratio is 54.63% to maximize ADG. The broken-line model is as follows: if x ≤ requirement, y = 511.2 – 9.54 × (48.33 – x), where estimated break-point is SID Ile-to-Lys ratio 48.33%.

Fig. 3. Representative histological micrographs in piglets fed diets with different standardized ileal digestible (SID) Ile-to-Lys ratios. The CP content of five treatments was consistent at 17.8%, and SID Ile-to-Lys ratios were 45% (N45), 50% (N50), 55% (N55), 60% (N60) and 65% (N65). CP = crude protein.

Fig. 4. Effects of standardized ileal digestible (SID) Ile-to-Lys ratios on mRNA expression level of tight junctional proteins in the ileum of weaned piglets. The results are presented as the mean and SEM. ^{a, b} Mean values with different letters differ at P < 0.05. (A) Occludin; (B) claudin; (C) zonula occludens-1 (ZO-1). The CP content of five treatments was consistent at 17.8%, and SID Ile-to-Lys ratios were 45% (N45), 50% (N50), 55% (N55), 60% (N60) and 65% (N65). SEM = standard error of the mean. CP = crude protein.

Fig. 5. Effects of standardized ileal digestible (SID) Ile-to-Lys ratios on cecal microbiota of weaned piglets. (A) Venn diagram. (B) Shannon index. (C) Chao index. (D, E) Barplot analysis of microbial composition at the phylum and family levels. (F) Heatmap analysis of microbial composition at the genus level. (G) LEfSe analysis from phylum to genus level among the five treatments. (H) LEfSe analysis from phylum to genus level between the N45 and N55 groups. The CP content of five treatments was consistent at 17.8%, and SID Ile-to-Lys ratios were 45% (N45), 50% (N50), 55% (N55), 60% (N60) and 65% (N65). CP = crude protein.

Fig. 6. Effects of standardized ileal digestible (SID) Ile-to-Lys ratios on colonic microbiota of weaned piglets. (A) Venn diagram. (B) Shannon index. (C) Chao index. (D, E) Barplot analysis of microbial composition at the phylum and family levels. (F) Heatmap analysis of microbial composition at the genus level. (G) LEfSe analysis from phylum to genus level among the five treatments. (H) LEfSe analysis from phylum to genus level between the N45 and N55 groups. The CP content of five treatments was consistent at 17.8%, and SID Ile-to-Lys ratios were 45% (N45), 50% (N50), 55% (N55), 60% (N60) and 65% (N65). CP = crude protein.

Articles: Latest Articles; Most Read; Collections

Updates: Events; News; Multimedia

About: About Us

Contact

No. 86 Xueyuan South Road, Haidian District, Beijing

100081

010-62199257

qkjq@cast.org.cn

Copyright © 2025 China Association for Science and Technology. All rights reserved. For all open access content, the relevant licensing terms apply.
Sponsored by the Office of the Leading Group for Cybersecurity and Informatization of CAST, and supported by Science and Technology Review Publishing House